https://www.open-bio.org/category/blogroll/Recent content in Blogroll on Open Bioinformatics FoundationHugoen-USboard@open-bio.org (Open Bioinformatics Foundation)board@open-bio.org (Open Bioinformatics Foundation)Wed, 29 Oct 2025 00:00:00 +0000https://www.open-bio.org/2025/10/29/biopython-1-86-released/Wed, 29 Oct 2025 00:00:00 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2025/10/29/biopython-1-86-released/<p>Biopython 1.86 has been released and is available from our <a href="https://biopython.org/wiki/Download">website</a> and <a href="https://pypi.python.org/pypi/biopython/1.86">PyPI</a>.</p> <p>This contains about nine months worth of updates, and is our first release with Python 3.14 support. See <a href="https://github.com/biopython/biopython/blob/biopython-186/NEWS.rst">change-log in the news file</a> (most of the changes are in <code>Bio.Align</code> and <code>Bio.PDB</code>). There have also been a few <a href="https://github.com/biopython/biopython/blob/biopython-186/DEPRECATED.rst">deprecations and removals of older code</a>.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors who were happy to be named:</p> <ul> <li>Rachel Stern (first contribution)</li> <li>Fabio Zanini</li> <li>Michiel de Hoon</li> <li>Oliver Wissett (first contribution)</li> <li>Peter Cock</li> <li>Samuel Prince (first contribution)</li> <li>Cassie Bastress (first contribution)</li> </ul>https://www.open-bio.org/2024/06/28/biopython-1-84-released/Fri, 28 Jun 2024 05:43:46 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2024/06/28/biopython-1-84-released/<p>Biopython 1.84 has been released and is available from our <a href="https://biopython.org/wiki/Download">website</a> and <a href="https://pypi.python.org/pypi/biopython/1.84">PyPI</a>.</p> <p>This contains about 5 months worth of updates, so the <a href="https://github.com/biopython/biopython/blob/biopython-184/NEWS.rst">change-log in the news file</a> is longer than usual. There have also been a few <a href="https://github.com/biopython/biopython/blob/biopython-184/DEPRECATED.rst">deprecations</a>, most noteworthy this may be our last release with Python 3.9 support.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Anil Tuncel (first contribution)</li> <li>David Cain</li> <li>Fabio Zanini (first contribution)</li> <li>Joao Rodrigues</li> <li>Judith Bernett (first contribution)</li> <li>Luca Monari (first contribution)</li> <li>Meridia Jane Bryant (first contribution)</li> <li>Manuel Lera-Ramirez</li> <li>Michael M. (first contribution)</li> <li>Michiel de Hoon</li> <li>Peter Cock</li> <li>Rudolf Koopmann (first contribution)</li> <li>Will Tyler (first contribution)</li> </ul>https://www.open-bio.org/2023/03/22/mailing-lists-to-paid-hosting/Wed, 22 Mar 2023 16:07:27 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2023/03/22/mailing-lists-to-paid-hosting/<p>We&rsquo;re sharing some important news with you regarding our mailing lists. From early on, we’ve maintained a self-hosted Mailman server for any OBF project that needs a mailing list, including our member roster list. After careful consideration, we have decided we need a solution that keeps track more reliably with current and emerging spam-fighting technologies and standards, and that simultaneously requires much less administration time and know-how. Specifically, we are planning to migrate the lists to paid hosting, possibly Mailchimp.</p> <p>As an open-source community, we understand the importance of using open solutions whenever possible. However, in this case, we feel that switching to a paid provider is the right call for our organization. Mailchimp will offer us a simpler solution  with features that should significantly improve the overall user experience for our members. Additionally, it will be easier for us to maintain and manage the mailing lists, which will free up resources for other important initiatives.</p> <p>We understand that open-source solutions are important to many of our members, but having a stable, reliable, user-friendly, and cost-effective mailing list is essential to our community&rsquo;s success. If you have personal experience with another mailing list provider that you believe would provide similar or better functionality than Mailchimp, and that is more open, we’d love to hear about it – please contact us by Monday 3 April 2023. You can submit your suggestions by leaving comments in <a href="https://github.com/OBF/obf-docs/issues/114">this GitHub issue</a>, or contact us in the <a href="https://join.slack.com/t/open-bio/shared_invite/zt-1pnswao9y-8igcckVxBXhQHCMweHt_NA">OBF Slack</a>.</p>https://www.open-bio.org/2023/03/17/hannah-wei-webinar-video-now-available/Fri, 17 Mar 2023 23:50:15 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2023/03/17/hannah-wei-webinar-video-now-available/<p><img src="https://www.open-bio.org/wp-content/uploads/2023/03/Moni-moderating-questions-for-Hannah-Wei-1-266x300.png" alt=""></p> <p>On March 14, 2023, we held a webinar (hosted by <a href="https://www.iscb.org/iscbacademy">ISCBacademy</a>) about &ldquo;Re-Thinking the Patient’s Role in a Learning Health System: Lessons from the Patient-Led Research Collaborative&rdquo; presented by Hannah Wei, co-founder and technologist at the Patient-Led Research Collaborative. See <a href="https://www.open-bio.org/2023/03/07/iscbacademy-webinar-on-patient-led-research/">the webinar announcement</a> for a full description.</p> <p>BOSC organizing committee member Monica Munoz-Torres introduced Ms. Wei and fielded a lively Q&amp;A session. The webinar recording is available on YouTube at <a href="https://youtu.be/M2vAotWKd_Q">https://youtu.be/M2vAotWKd_Q</a>.</p> <p>The <a href="https://www.iscb.org/iscbacademy">ISCBacademy</a> is a series of free webinars offered by the <a href="https://www.iscb.org/">ISCB</a>, which runs the annual ISMB conference, through the ISCB Communities of Special Interest (COSIs), which include BOSC/OBF. Each COSI gets two webinar slots per year, so watch for our next one in fall 2023!</p>https://www.open-bio.org/2022/01/27/approved-by-obf-membership-vote/Thu, 27 Jan 2022 23:08:50 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2022/01/27/approved-by-obf-membership-vote/<p>As previously described, during the November 2021 public Board meeting, <a href="https://www.open-bio.org/2022/01/04/obf-membership-referendum/">the OBF announced two new initiatives to be voted on by the OBF membership</a>. Both of these <a href="https://vote.heliosvoting.org/helios/e/obf-coc-css">received a large majority of votes</a>:</p> <ol> <li>OBF Community Support Sponsorship (53 for, 3 against, 2 abstaining)</li> <li>OBF Code of Conduct (54 for, 2 against, 1 abstaining)</li> </ol> <p>The work to set up the new Community Support Sponsorship is <a href="https://github.com/OBF/obf-docs/issues/86">underway</a>. The new Code of Conduct is now available on the <a href="https://www.open-bio.org/code-of-conduct/">OBF website.</a></p>https://www.open-bio.org/2022/01/20/iscbacademy-webinar-feb-22-yo-yehudi/Thu, 20 Jan 2022 22:12:00 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2022/01/20/iscbacademy-webinar-feb-22-yo-yehudi/<p>Date &amp; Time: Tuesday, February 22, 2022, 15:00 UTC / 11am EDT</p> <p>Location: online webinar hosted by ISCB</p> <p>Speaker: Yo Yehudi, Open Life Science (former OBF board member and Google Summer of Code admin &amp; mentor)</p> <p>Topic: Growing open source communities with internships</p> <p>The ISCB, which runs the annual ISMB conference, is offering a series of <a href="https://www.iscb.org/iscbacademy-webinars">ISCBacademy webinars</a> hosted by the Communities of Special Interest (COSIs), which include BOSC/OBF. These webinars are free to ISCB members.</p> <p>If you are not an ISCB member but would like to register to attend this webinar, and the <a href="https://www.iscb.org/iscb-membership-dues">fee (which ranges from $5-$135)</a> is a barrier, <strong><a href="https://docs.google.com/forms/d/e/1FAIpQLSf-8YnrYfB2vFpiRjvcMChJOk_KSNEmgsPwF_8Ffxlz0NvpXQ/viewform">please fill out our application for a fee waiver</a></strong>.</p> <p>Building communities for your open source computational tooling requires more than just technical expertise, and often isn&rsquo;t as straightforward as building the tool itself. Having a community of contributors and users can make a big difference in many ways - additional community members will spot opportunities and bugs in your code that previously you didn&rsquo;t notice, and may be able to offer unique skill sets to your team.</p> <p>One effective way to grow your community can be via internships. Programs such as <a href="https://summerofcode.withgoogle.com/">Google Summer of Code</a> and <a href="https://www.outreachy.org/">Outreachy</a> offer the chance to work with interns for 6-12 weeks, working on individual supervised projects whilst getting paid for their work.</p> <p>This webinar will cover the ins and outs of participating in internship programs like this, from the perspective of a mentoring organisation. Topics will include:</p> <p>1. Getting started with internship programs - finding mentors and defining a set of projects</p> <p>2. Time commitments for mentors, before the application period and after interns are selected.</p> <p>3. Funding for internship programs! (It&rsquo;s not as tricky as you may fear - others handle this bit!)</p> <p>4. Keeping interns engaged during the program and bringing them in as long-term contributors afterwards.</p> <p>This webinar will be run by <strong>Yo Yehudi</strong>, who has been a mentor and organisation administrator for interns in GSoC and Outreachy since 2017, supervising over 35 interns for various open source organisations, and who co-leads <a href="https://openlifesci.org/">Open Life Science</a>, an organisation dedicated to training open research community builders.</p>https://www.open-bio.org/2021/01/28/domain-names-available-for-adoption/Thu, 28 Jan 2021 09:26:16 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2021/01/28/domain-names-available-for-adoption/<p>The OBF has two sets of domain names available for adoption by a non-profit or open source project: biows.org, biows.com, biows.net and biocpp.org, biocpp.com, biocpp.net</p> <p>These domains were registered and donated to us with bio-web-services (biows) and bio-c-plus-plus (BioC++ or BioCPP) in mind, but we&rsquo;ve failed to find a good home for them.</p> <p>Please note that this is like adopting a free puppy - we&rsquo;ll transfer them at no cost, but domain names come with annual renewal charges which the recipient organisation would be responsible for paying.</p> <p>Serious enquiries to the OBF board by email by the end of February 2020 please.</p>https://www.open-bio.org/2020/11/04/google-summer-of-code-2020-wrap-up/Wed, 04 Nov 2020 10:06:46 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2020/11/04/google-summer-of-code-2020-wrap-up/<p>OBF was accepted as a mentoring organisation for Google Summer of Code this year. It was another good year for OBF, with Kai Blin, Michael R. Crusoe, Sarthak Sehgal, and Yo Yehudi as administrators. We hosted eight students all of which successfully completed their work:</p> <ol> <li><a href="https://summerofcode.withgoogle.com/archive/2020/projects/4898360579850240/">Srijan Verma</a> (mentors: Dmitry Petrov, Dymitr Nowicki, Vlada Tyshchenko, Anton Kulaga) - Healthcare-Researcher-Connector (HRC): A Federated Learning package for bridging the gap between Healthcare providers and researchers</li> <li><a href="https://summerofcode.withgoogle.com/archive/2020/projects/6576740249370624/">Himanshi Mathur</a> (mentors: Jun Aruga, Evan Nemerson, Michael R. Crusoe) - Implementation of SVML in SIMDe ( <a href="https://medium.com/@himanshi18037/final-work-product-gsoc-2020-5fba8744cbcf">final report</a>, <a href="https://medium.com/@himanshi18037">other blogs</a>, <a href="https://simd-everywhere.github.io/blog/">SIMD Everywhere</a>)</li> <li><a href="https://summerofcode.withgoogle.com/archive/2020/projects/6238152676605952/">Boshen Yan</a> (mentors: Amal Thomas, Marius Beek, Saket) - Implementing user-friendly search features in PysraDB ( <a href="https://bscrow.github.io/gsoc2020.html">final report</a>, <a href="https://github.com/bscrow/pysradb/blob/basic-search-feature/WEEKLY_WRITEUP.md">weekly writeup</a>, <a href="https://bscrow.github.io/gsoc2020.html">work summary</a>)</li> <li><a href="https://summerofcode.withgoogle.com/archive/2020/projects/5403269754519552/">Shekhar Shukla</a> (mentors: Oliver Alka, Hannes Röst, Timo Sachsenberg) - OpenMS R Package ( <a href="https://gist.github.com/24sharkS/7cb791091a8301f7c8460f15c04b97a0">final report</a>, <a href="https://24sharks.github.io/">blogs</a>, <a href="https://github.com/OpenMS/OpenMS/projects/31">OpenMS</a>)</li> <li><a href="https://summerofcode.withgoogle.com/archive/2020/projects/5109120027328512/">Francesco Porto</a> (mentors: George Githinji, Erik Garrison, Pjotr Prins) - Parallel Graph Traversal for Variation Graphs</li> <li><a href="https://summerofcode.withgoogle.com/archive/2020/projects/6302555174338560/">Eliza Martin</a> (mentors: Dymitr Nowicki, Vlada Tyshchenko, Anton Kulaga) - Protein sequence and structural analysis CWL pipeline for comparative biology</li> <li><a href="https://summerofcode.withgoogle.com/archive/2020/projects/4905563541995520/">Hidayat Ullah Khan</a> (mentors: Jun Aruga, Evan Nemerson, Michael R. Crusoe) - SIMDe: Add implementations of ISA extensions (SSE4.2 and AVX512) and NEON implementations of SSE4.1,SSE4.2,SSE3,SSSE3 ISA extension ( <a href="https://masterchef2209.wordpress.com/2020/08/26/final-work-product-submission-report-google-summer-of-code-2020/">final report</a>, <a href="https://masterchef2209.wordpress.com/2020/06/17/guide-to-intel-sse4-2-crc-intrinisics-implementation-for-simde/">mentee blogposts</a>, <a href="https://simd-everywhere.github.io/blog/">SIMD Everywhere</a>)</li> <li><a href="https://summerofcode.withgoogle.com/archive/2020/projects/5225514815455232/">T. Waschischeck</a> (mentors: Chris Bielow, Julianus Pfeuffer) - Using DeNovo Sequencing to Predict Protein Database Suitability ( <a href="https://openmsgsoc2020.blogspot.com/2020/08/gsoc-final-report.html">final report</a>, <a href="https://openmsgsoc2020.blogspot.com/">student blog</a>, <a href="https://github.com/OpenMS/OpenMS/projects/30">OpenMS</a>)</li> </ol> <p>This year, OBF received 5000 USD from Google for being a mentoring organisation. The funds from GSoC go into the general OBF Fund that is primarily used to sponsor <a href="https://www.open-bio.org/event-awards/">OBF Event Fellowships</a> which is a program aimed at increasing diverse participation at events promoting open science practices such as resource development and dissemination in the bioinformatics and biological research community.</p> <p>Thank you to all our volunteer GSoC administrators and mentors - and of course thank you to the students - we hope you&rsquo;ll continue to work in bioinformatics and/or open source.</p>https://www.open-bio.org/2020/09/04/biopython-1-78-released/Fri, 04 Sep 2020 12:11:00 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2020/09/04/biopython-1-78-released/<p>Biopython 1.78 has been released and is available from our <a href="https://biopython.org/wiki/Download">website</a> and <a href="https://pypi.python.org/pypi/biopython/1.78">PyPI</a>.</p> <p>The main change is that <code>Bio.Alphabet</code> is no longer used. In some cases you will now have to specify expected letters, molecule type (DNA, RNA, protein), or gap character explicitly. Please consult the updated <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Tutorial</a> and <a href="https://biopython.org/docs/1.78/api/">API documentation</a> for guidance. This simplification has sped up many <code>Seq</code> object methods. See <a href="https://biopython.org/wiki/Alphabet">https://biopython.org/wiki/Alphabet</a> for more information.</p> <p><code>Bio.SeqIO.parse()</code> is faster with &ldquo;fastq&rdquo; format due to small improvements in the <code>Bio.SeqIO.QualityIO</code> module.</p> <p>The <code>SeqFeature</code> object&rsquo;s <code>.extract()</code> method can now be used for trans-spliced locations via an optional dictionary of references.</p> <p>As in recent releases, more of our code is now explicitly available under either our original &quot; <em>Biopython License Agreement</em>&quot;, or the very similar but more commonly used &quot; <em>3-Clause BSD License</em>&quot;. See the <code>LICENSE.rst</code> file for more details.</p> <p>Additionally, a number of small bugs and typos have been fixed with additions to the test suite. There has been further work to follow the Python PEP8, PEP257 and best practice standard coding style, and all of the tests have been reformatted with the <code>black</code> tool to match the main code base.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Adam Sjøgren (first contribution)</li> <li>Carlos Pena</li> <li>Chris Daley</li> <li>Chris Rands</li> <li>Christian Brueffer</li> <li>Damien Goutte-Gattat</li> <li>João Rodrigues</li> <li>João Vitor F Cavalcante (first contribution)</li> <li>Marie Crane</li> <li>Michiel de Hoon</li> <li>Peter Cock</li> <li>Sergio Valqui</li> <li>Yogesh Kulkarni (first contribution)</li> <li>Zheng Ruan</li> </ul>https://www.open-bio.org/2020/05/25/biopython-1-77-released/Mon, 25 May 2020 14:34:47 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2020/05/25/biopython-1-77-released/<p>Biopython 1.77 has been released and is available from our <a href="https://biopython.org/wiki/Download">website</a> and <a href="https://pypi.python.org/pypi/biopython/1.77">PyPI</a>.</p> <p>This is the first release since we dropped support for Python 2.7 and 3.5. Focusing on Python 3.6 or later will let us take advantage of new functionality and syntax, and simplify our code base and testing.</p> <p>This release of Biopython supports Python 3.6, 3.7 and 3.8 It has also been tested on PyPy3.6.1 v7.1.1.</p> <p><code>pairwise2</code> now allows the input of parameters with keywords and returns the alignments as a list of <code>namedtuples</code>.</p> <p>The codon tables have been updated to NCBI genetic code table version 4.5, which adds <em>Cephalodiscidae</em> mitochondrial as table 33.</p> <p><code>Bio.Restriction</code> has been updated to the January 2020 release of REBASE.</p> <p>A major contribution by Rob Miller to <code>Bio.PDB</code> provides new methods to handle protein structure transformations using dihedral angles (internal coordinates). The new framework supports lossless interconversion between internal and cartesian coordinates, which, among other uses, simplifies the analysis and manipulation of coordinates of protein structures.</p> <p>As in recent releases, more of our code is now explicitly available under either our original &quot; <em>Biopython License Agreement</em>&quot;, or the very similar but more commonly used &quot; <em>3-Clause BSD License</em>&quot;. See the <code>LICENSE.rst</code> file for more details.</p> <p>Additionally, a number of small bugs and typos have been fixed with further additions to the test suite. There has been further work to follow the Python PEP8, PEP257 and best practice standard coding style, and more of the code style has been reformatted with the <code>black</code> tool.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Alexander Decurnou (first contribution)</li> <li>Andrei Istrate (first contribution)</li> <li>Andrey Raspopov</li> <li>Austin Varela (first contribution)</li> <li>Chris Daley</li> <li>Chris Rands</li> <li>Deepak Khatri</li> <li>Hielke Walinga (first contribution)</li> <li>Kai Blin</li> <li>Karthikeyan Singaravelan (first contribution)</li> <li>Markus Piotrowski</li> <li>Michiel de Hoon</li> <li>Peter Cock</li> <li>Rob Miller</li> <li>Sergio Valqui</li> <li>Steve Bond</li> <li>Sujan Dulal (first contribution)</li> <li>Tianyi Shi (first contribution)</li> </ul> <p><em>Update</em>: And the following two whom we had initially wrongly listed under the previous release:</p> <ul> <li>Artemi Bendandi (first contribution)</li> <li>Konstantinos Zisis (first contribution)</li> </ul>https://www.open-bio.org/2019/12/20/biopython-1-76-released/Fri, 20 Dec 2019 15:02:10 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2019/12/20/biopython-1-76-released/<p>Biopython 1.76 has been released and is available from our <a href="https://biopython.org/wiki/Download">website</a> and <a href="https://pypi.python.org/pypi/biopython/1.76">PyPI</a>.</p> <p>Coming relatively soon after our last release, the timing is linked to the official end of life for Python 2, and a <a href="https://python3statement.org/">focus hereafter on Python 3</a>. We intend this to be our final release supporting Python 2.7 and 3.5. Focusing on Python 3.6 or later will let us take advantage of new functionality and syntax, and simplify our code base and testing.</p> <p>This release of Biopython supports Python 2.7, 3.5, 3.6, 3.7 and 3.8. It has also been tested on PyPy2.7.13 v7.1.1 and PyPy3.6.1 v7.1.1-beta0.</p> <p>As in recent releases, more of our code is now explicitly available under either our original &quot; <em>Biopython License Agreement</em>&quot;, or the very similar but more commonly used &quot; <em>3-Clause BSD License</em>&quot;. See the <code>LICENSE.rst</code> file for more details.</p> <p>In addition to the mainstream <code>x86_64</code> aka <code>AMD64</code> CPU architecture, we now also test every contribution on the <code>ARM64</code>, <code>ppc64le</code>, and <code>s390x</code> CPUs under Linux thanks to Travis CI. Further post-release testing done by Debian and other packagers and distributors of Biopython also covers these CPUs.</p> <p>The <code>Bio.motifs.PositionSpecificScoringMatrix.search()</code> method has been re-written: it now applies <code>.calculate()</code> to chunks of the sequence to maintain a low memory footprint for long sequences.</p> <p>Additionally, a number of small bugs and typos have been fixed with further additions to the test suite. There has been further work to follow the Python PEP8, PEP257 and best practice standard coding style, and more of the code style has been reformatted with the <code>black</code> tool.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Chris Daley (first contribution)</li> <li>Chris Rands</li> <li>Christian Brueffer</li> <li>Ilya Flyamer (first contribution)</li> <li>Jakub Lipinski (first contribution)</li> <li>Michael R. Crusoe (first contribution)</li> <li>Michiel de Hoon</li> <li>Peter Cock</li> <li>Sergio Valqui</li> </ul>https://www.open-bio.org/2019/11/07/biopython-1-75-released/Thu, 07 Nov 2019 16:31:13 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2019/11/07/biopython-1-75-released/<p>Dear Biopythoneers,</p> <p>Biopython 1.75 has been released and is available from our <a href="https://biopython.org/wiki/Download">website</a> and <a href="https://pypi.python.org/pypi/biopython/1.75">PyPI</a>.</p> <p>This release of Biopython supports Python 2.7, 3.5, 3.6, 3.7 and is expected to work on the soon to be released Python 3.8. It has also been tested on PyPy2.7.13 v7.1.1 and PyPy3.6.1 v7.1.1-beta0.</p> <p>Note we intend to drop Python 2.7 support in early 2020.</p> <p>The restriction enzyme list in Bio.Restriction has been updated to the August 2019 release of REBASE.</p> <p><code>Bio.SeqIO</code> now supports reading and writing files in the native format of Christian Marck&rsquo;s DNA Strider program (&ldquo;xdna&rdquo; format, also used by Serial Cloner), as well as reading files in the native formats of GSL Biotech&rsquo;s SnapGene (&ldquo;snapgene&rdquo;) and Textco Biosoftware&rsquo;s Gene Construction Kit (&ldquo;gck&rdquo;).</p> <p><code>Bio.AlignIO</code> now supports GCG MSF multiple sequence alignments as the &ldquo;msf&rdquo; format (work funded by the National Marrow Donor Program).</p> <p>The main <code>Seq</code> object now has string-like <code>.index()</code> and <code>.rindex()</code> methods, matching the existing <code>.find()</code> and <code>.rfind()</code> implementations. The <code>MutableSeq</code> object retains its more list-like <code>.index()</code> behaviour.</p> <p>The <code>MMTFIO</code> class has been added that allows writing of MMTF file format files from a Biopython structure object. <code>MMTFIO</code> has a similar interface to <code>PDBIO</code> and <code>MMCIFIO</code>, including the use of a <code>Select</code> class to write out a specified selection. This final addition to read/write support for PDB/mmCIF/MMTF in Biopython allows conversion between all three file formats.</p> <p>Values from mmCIF files are now read in as a list even when they consist of a single value. This change improves consistency and reduces the likelihood of making an error, but will require user code to be updated accordingly.</p> <p><code>Bio.PDB</code> has been updated to support parsing REMARK 99 header entries from PDB-style Astral files.</p> <p>A new keyword parameter <code>full_sequences</code> was added to <code>Bio.pairwise2</code>&rsquo;s pretty print method <code>format_alignment</code> to restore the output of local alignments to the &lsquo;old&rsquo; format (showing the whole sequences including the un-aligned parts instead of only showing the aligned parts).</p> <p>A new function <code>charge_at_pH(pH)</code> has been added to <code>ProtParam</code> and <code>IsoelectricPoint</code> in <code>Bio.SeqUtils</code>.</p> <p>The <code>PairwiseAligner</code> in <code>Bio.Align</code> was extended to allow generalized pairwise alignments, i.e. alignments of any Python object, for example three-letter amino acid sequences, three-nucleotide codons, and arrays of integers.</p> <p>A new module <code>substitution_matrices</code> was added to <code>Bio.Align</code>, which includes an <code>Array</code> class that can be used as a substitution matrix. As the <code>Array</code> class is a subclass of a numpy array, mathematical operations can be applied to it directly, and C code that makes use of substitution matrices can directly access the numerical values stored in the substitution matrices. This module is intended as a replacement of <code>Bio.SubsMat</code>, which is currently unmaintained.</p> <p>As in recent releases, more of our code is now explicitly available under either our original &ldquo;Biopython License Agreement&rdquo;, or the very similar but more commonly used &ldquo;3-Clause BSD License&rdquo;. See the <code>LICENSE.rst</code> file for more details.</p> <p>Additionally, a number of small bugs and typos have been fixed with further additions to the test suite, and there has been further work to follow the Python PEP8, PEP257 and best practice standard coding style. We have also started to use the <code>black</code> Python code formatting tool.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Chris MacRaild</li> <li>Chris Rands</li> <li>Damien Goutte-Gattat (first contribution)</li> <li>Devang Thakkar</li> <li>Harry Jubb</li> <li>Joe Greener</li> <li>Kiran Mukhyala (first contribution)</li> <li>Konstantin Vdovkin</li> <li>Mark Amery</li> <li>Markus Piotrowski</li> <li>Mike Moritz (first contribution)</li> <li>Mustafa Anil Tuncel</li> <li>Nick Negretti</li> <li>Peter Cock</li> <li>Peter Kerpedjiev</li> <li>Sergio Valqui</li> <li>Spencer Bliven</li> </ul>https://www.open-bio.org/2019/09/30/obf-travel-fellowship-august-2019-awards/Mon, 30 Sep 2019 08:38:33 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2019/09/30/obf-travel-fellowship-august-2019-awards/<p>A record number of people applied for the latest round of the <a href="https://www.open-bio.org/travel-awards/">OBF Travel Fellowship</a>, which closed on August 15, 2019. Out of this great set of applicants, we offered travel awards to three who epitomize the goal of the awards: to promote diversity in the world of open source bioinformatics / open science.</p> <p>The awardees are <strong>Arunav Konwar,</strong> <strong>Fernanda Troyner and Nicolás Palopoli</strong>.</p> <p><strong>Arunav</strong> has contributed to open source projects including <a href="https://github.com/deep-learning-indaba/Baobab">Deep Learning Indaba</a> (an African Machine Learning community), Wikimedia, and <a href="https://metafluidics.org">Metafluidics.</a> He will give a talk and lead a workshop at the <a href="https://www.biosummit.org/">Global Community Bio Summit 3.0,</a> which aims to democratize biotechnology by building an inclusive global network of people in the life sciences.</p> <p><strong>Fernanda</strong>, who participated in &quot; <a href="https://www.reprodutibilidade.bio.br/nobudgetsciencehackweek">No Budget Science Hack Week</a>&quot;, is fairly new to open science; she attended the Hack Week to learn about software tools for open science and launch her own open science project. She participates in the <a href="https://www.reprodutibilidade.bio.br/home">Brazilian Reproducibility Initiative</a>.</p> <p><strong>Nicolás</strong> will be co-leading the first <a href="https://carpentries.org/become-instructor/">Carpentries Instructor training</a> in Lima, Peru, in October. He later declined the fellowship as the local organizers offered to cover his travel expenses.</p> <p>Big congratulation to our awardees! We look forward to hearing more about their open source/science projects in future.</p>https://www.open-bio.org/2019/08/27/tips-for-informal-discussions/Tue, 27 Aug 2019 22:36:32 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2019/08/27/tips-for-informal-discussions/<p><em>The <a href="https://www.open-bio.org">Open Bioinformatics Foundation (OBF)</a> sponsors a Travel Fellowship program aimed at increasing diverse participation at events promoting open source bioinformatics software development and open science in the biological research community. Malvika&rsquo;s participation at <a href="https://www.open-bio.org/events/bosc/about/">Bioinformatics Open Source Conference</a> 2019 was supported by this fellowship granted to her in January 2019. Find more information <a href="https://www.open-bio.org/travel-awards/">here.</a></em></p> <p>The phrase ‘water cooler effect’ is derived from informal gatherings and connections made around water coolers (or vending machines these days!) at the workplace or other formal situations. Such unplanned encounters lead to genuine connections between people resulting in meaningful and productive collaborations. Many research organizations value the importance of such serendipitous interactions, and actively promote them in their work-culture. Conference organizers also recognize its effectiveness and design their program with longer coffee breaks, dedicated slots for informal discussions and designated venues for breakout sessions.</p> <p><img src="https://images.unsplash.com/photo-1563461661026-49631dd5d68e?ixlib=rb-1.2.1&amp;ixid=eyJhcHBfaWQiOjEyMDd9&amp;auto=format&amp;fit=crop&amp;w=1500&amp;q=80" alt="People interacting informally"></p> <p><em>Image on <a href="https://unsplash.com/photos/5H0p6JPUHbI">Unsplash by @productschool</a></em></p> <p>Since 2000, the <a href="https://www.open-bio.org/events/bosc/about/">Bioinformatics Open Source Conference (BOSC)</a> has been bringing together bioinformaticians and computational researchers interested in Open Science, to provide opportunities for them to discuss their projects, exchange ideas, learn about the latest practices in bioinformatics, and collaborate with each other. These meetings are attended by participants with different backgrounds, which provides them with a unique environment to gain multiple perspectives into different technical and social issues within the bioinformatics community. To facilitate informal interactions that promote the water cooler effects, attendees are encouraged to lead or take part in the participant-driven discussion sessions called <a href="https://en.wikipedia.org/wiki/Birds_of_a_feather_(computing)">Birds of a feather (BoF)</a> on topics of interest to them. Since these sessions are very short, session facilitators try to encourage interactions between the participants, while making effective use of the allocated time, welcoming different viewpoints, and finishing the session with some defined outcome or future directions.</p> <p><img src="https://images.unsplash.com/photo-1557734864-c78b6dfef1b1?ixlib=rb-1.2.1&amp;auto=format&amp;fit=crop&amp;w=1782&amp;q=80" alt="discussion session"></p> <p><em>Image on <a href="https://unsplash.com/photos/QiIxg_q2vh0">Unsplash by @zainulyasni6118</a></em></p> <p>I attended my first BoF on the topic of <a href="http://www.hub-hub.de/wordpress/?p=327">“Unseminar”</a> at the BOSC 2013, where I first met <a href="https://twitter.com/AidanBudd">Aidan Budd</a> who was leading this session. Aidan chose the <a href="http://www.theworldcafe.com/key-concepts-resources/world-cafe-method/">World Cafe method</a> to facilitate this session, where participants could form smaller groups to discuss related topics and switch groups to join different discussions. This informal setting was quite different from the usual speaker-centric format of conferences because it was participant-driven. Everyone immediately felt welcome and included in this session because the emphasis was on learning about the topic at hand together as a group. For a fresh grad student like me, this was a very special experience because I could truly co-exist as a scientist with people of varying levels of experience without feeling like an imposter or someone who didn’t belong there. This discussion didn’t end with the session itself, but catalyzed a much longer discussion after the conference over emails and shared documents, which finally led to a crowdsourced <a href="https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1003905">publication on “Ten Simple Rules for Organizing an Unconference”</a>, several long-lasting collaborations among the participants, and Aidan became my mentor and a close friend.</p> <p>As a community manager, informal discussion sessions are hands-down my favourite way to connect with others, promote collaborations between the existing members of the community and welcome new members while encouraging active participation from them. Since my first encounter with BoFs, I have participated in and led several discussion sessions. In particular, I facilitated one BoF session at BOSC 2017 in Prague, and one session this year in Basel during my participation at BOSC 2019, which was supported by the <a href="https://www.open-bio.org/travel-awards">OBF fellowship</a>, granted to me in December 2018 application round.</p> <blockquote> <p>off = BoF* :), i.e. Birds of a feather - where people with a common interest can discuss the topic together.</p> <p>— Malvika Sharan (@MalvikaSharan) <a href="https://twitter.com/MalvikaSharan/status/1154007583730126848?ref_src=twsrc%5Etfw">July 24, 2019</a></p> </blockquote> <p>Here are my <strong>top 5 tips for facilitating BoFs</strong> or similar discussion sessions that promote the informal and unplanned aspects of the water cooler effect.</p> <p>1. <strong>Set the ground rules</strong></p> <p>Start your session by welcoming everyone and highlighting the main points of your organization’s/conference’s Code of Conduct. By choosing an inclusive discussion format (see <a href="https://acrl.ala.org/IS/is-committees-2/committees-task-forces/discussion-group-steering/possible-discussion-format-options/">this post by The Instruction Section, ACRL</a> for ideas) we can provide a platform for our attendees to participate equitably. It is also useful to introduce a few simple tips for effective discussions, for example, by inviting volunteers to take different roles such as notetaker, timekeeper, or chair in different groups to ensure that everyone’s voice is heard and noted (see <a href="https://files.adainitiative.org/wiki_binaries/role_cards.pdf">this role card by Ada Initiative</a>).</p> <p><strong>2. Get everyone on the same page</strong></p> <p>State the objective of your sessions clearly so that your participants know what to expect. You shouldn’t assume that participants will know the specific details essential to discuss the topic (we can always ask!), therefore, you can take the first few minutes to briefly introduce the topic and the main terminologies. It’s important to clarify what they will and will not discuss in your session.</p> <p><strong>3. Manage your time effectively</strong></p> <p>Be thoughtful and appreciative of people’s time that they invest in your sessions. Conferences can be stressful. Listening to talks, taking down notes, and getting introduced to new topics while coping with the busy schedule, new venues, and jet-lag can be both mentally and physically exhausting. Therefore informal sessions should not demand too much effort from our attendees and should allow them to decompress. To make everyone’s time count, you can share a clear agenda and divide your session into short rounds. When a session is attended by a large number of participants, it’s more effective to split them into smaller groups where they can discuss different aspects of the given topic. We should also encourage people to switch groups to maximize their chances for personal interactions. As facilitators, we should minimize our own contribution but shouldn&rsquo;t hesitate to bring the focus back to the topic when the discussions derail.</p> <p><strong>4. Make it truly collaborative</strong></p> <p>Short sessions are great for brainstorming and generating new ideas. To ensure that these ideas don’t get lost after the session is over, there should be possibilities for your participants to collaboratively explore the topic and take notes. Each group can be provided with pens, sticky notes, flip charts, and/or whiteboards to facilitate note-taking or drawing concept maps. Online documents such as Etherpad, google docs and GitHub are generally used for sharing details of the sessions, offering a place for everyone to exchange their contact information, store their notes, add questions, and refer back to after the session is over. These online tools can be distracting if not balanced well with in-person collaborative activities (see this excellent <a href="https://uwaterloo.ca/centre-for-teaching-excellence/teaching-resources/teaching-tips/alternatives-lecturing/discussions/facilitating-effective-discussions">post on facilitating discussions</a> by University of Waterloo). Each group discussion can be guided by a set of questions or scenarios and the chair of each group can be asked to share the outcome of their discussion with everyone.</p> <p><strong>5. Communicate your next steps</strong></p> <p>Even though these events are short, it’s always useful to use a few minutes towards the end of the sessions to bring the entire group together to invite final thoughts and possible directions for the discussed topic and ideas. You can set a few channels of communication that the attendees can use in order to connect with each other and continue the discussion afterward. Since we want to be mindful of the contributions made by our participants, it’s important to let them know where and how the outcome of their discussions will be used, how they can reuse the material, and where they can access them in the future. After the conference, a summary of the session in a collaborative document and further details can be shared with a “Thank You” email.</p> <p><img src="https://pbs.twimg.com/media/DFVqupbXoAI9eCV?format=jpg&amp;name=medium" alt="BOSC 2017"></p> <p><em>Picture from a BoF I facilitated during BOSC 2017 on &lsquo;Promoting Diversity at Bioinformatics Conferences&rsquo;</em></p> <p>To conclude, informal discussion sessions are useful for collecting ideas, gaining perspectives, and engaging with others over informal conversations on topics of mutual interests. With a little pre-planning, these meetings can turn an idea discussed over coffee or by the water coolers into useful community-driven projects. I hope you find these tips useful and take advantage of this format at the next BOSC or in your community events.</p> <p>Do let me know on twitter ( <a href="https://twitter.com/MalvikaSharan">@malvikasharan</a>) which of your favourite tips are missing in the post.</p>https://www.open-bio.org/2019/08/27/dos-and-donts-for-computational-training/Tue, 27 Aug 2019 09:49:06 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2019/08/27/dos-and-donts-for-computational-training/<h6 id="thanks-to-obf-support-with-a-travel-grant-i-was-able-to-attend-the-first-european-carpentryconnect-event-in-manchester-ccmcr19-organized-by-thesoftware-sustainability-institute">Thanks to OBF support with a <a href="https://www.open-bio.org/travel-awards/">travel grant</a>, I was able to attend the first European CarpentryConnect event in Manchester CCMcr19 organized by The Software Sustainability Institute.</h6> <p><img src="https://i.imgur.com/rKTSHED.png" alt="">Colourful Manchester days post Pride weekend</p> <p><strong>The <a href="https://carpentries.org/">Carpentries</a> is a global community with a mission to teach</strong> essential data and foundational computational skills to researchers for conducting efficient, open, and reproducible research. The community includes instructors, trainers, maintainers and many more helpers and supporters on a global scale.</p> <p>This was my first CCMcr19 and first Carpentry event. I was curious to know more about the community, their computational efforts and inclusive practices and CCMcr19 seemed like a good place to start.</p> <p>I joined the computational world a few years ago, after moving from “wet” to “dry” lab. Shortly after the transition, I started delivering computational training and naturally, as a novice trainer, my main focus was on the material in terms of what to cover, how relevant it is, in what order do I present it and so on.</p> <p>When I faced my first classroom, I quickly realized that prepping the material and doing my research was the easy part. Instead, I found myself thinking of the other factors that contribute to the participants&rsquo; learning experience such as; how do I address and interact with them, how do I account for their very diverse demographics such as gender, age and language.</p> <p><img src="https://i.imgur.com/5ppP8SE.jpg" alt="">Diversity and Inclusion CCMcr19 Ms. Brönte</p> <p>Our classrooms today are not what they used to be 10 years ago. Participants come from all over the world and all walks of life, in other words, very diverse. This is especially true in computational training. For instance, bioinformatics training events in EMBL-EBI have two different types of attendees, one of which is made of plastic; <a href="https://www.ebi.ac.uk/about/news/announcements/bioinformatics-training-with-robot-avatars">robot avatars</a> allowing students to participate virtually without having to be physically there.</p> <p>Providing training and access to computational and cloud-based resources, enables researchers, especially those with limited resources, to work along with international partners, thereby contributing to open, reproducible research and helping improve research quality by bringing new perspectives.</p> <blockquote> <p>Question is, how do we improve and adapt our training sessions to be more inclusive accounting for a diverse range of demographics?</p> </blockquote> <p>I turned to the Carpentries community to learn from their collective experiences to help create a Dos and Don’ts checklist for computational teaching. The continuous contributions from trainers, as well as trainees, will help build a resource with advice on how to be mindful of diversity, equality and inclusion issues that play a role in training practices.</p> <p>CCMcr19 was a three-day event with a very dynamic and interactive format with a twist.</p> <p>Unlike many tech-oriented events, CCMcr19 covered a wide range of topics related to computational training, including advancing inclusive practices in the community and <a href="https://software.ac.uk/blog/2019-04-24-can-we-increase-our-impact-reducing-it-thoughts-environmental-sustainability">environmental initiatives</a>.</p> <blockquote> <p>My first day &amp; first <a href="https://twitter.com/hashtag/CCMcr19?src=hash&amp;ref_src=twsrc%5Etfw">#CCMcr19</a>, I&rsquo;m impressed!! Lovely people, great food, environmental awareness, dog, magician, doodler and above all interesting discussions and tons of things to learn! Defo a conference with a twist 😉! Thanks to the organisers! <a href="https://twitter.com/hashtag/Day2?src=hash&amp;ref_src=twsrc%5Etfw">#Day2</a> <a href="https://twitter.com/hashtag/BringItOn?src=hash&amp;ref_src=twsrc%5Etfw">#BringItOn</a> <a href="https://t.co/Dslqiz1HOe">https://t.co/Dslqiz1HOe</a></p> <p>— Dr. Sara El-Gebali (@yalahowy) <a href="https://twitter.com/yalahowy/status/1143776558651514881?ref_src=twsrc%5Etfw">June 26, 2019</a></p> </blockquote> <p>To encourage attendees to contribute to reducing impact on the environment at the conference, the <strong>Reusable Cup Raffle</strong> was introduced. We took a photo of our reusable cup/other reusable items such as reusable lanyards and badges, then tweeted about it using the hashtag # <a href="https://twitter.com/hashtag/CCMcr19ReusableLanyards?src=hashtag_click">CCMcr19ReusableLanyards</a> &amp; # <a href="https://twitter.com/hashtag/CCMcr19ReduceCO2?src=hashtag_click">CCMcr19ReduceCO2</a> and the raffle was drawn.</p> <blockquote> <p>Guess who won?</p> </blockquote> <p><img src="https://www.open-bio.org/wp-content/uploads/2019/08/Sara-Elgebali-we-won-1024x768.jpg" alt="">We won!</p> <p>After learning about the Carpentries and their inspiring work on day 1. I carried out my workshop titled Dos and Don’ts for computational training on day 2. I was joined by 10 participants, all of whom have experience in delivering training.</p> <p><img src="https://i.imgur.com/gruhfO3.jpg" alt="">Group discussions</p> <p>The first exercise we did was getting to know each other; background, expectations and anticipated outcomes.</p> <blockquote> <p><strong><em>“Know your audience”</em></strong></p> </blockquote> <p>After the groups formed organically, people started sharing their experiences and each group started noting down their observations, contributing to the list of advice.</p> <blockquote> <p><strong><em>“</em> Do’s and Don’ts in computational training”</strong></p> </blockquote> <p>As the discussion became more lively and engaging, it was evident that we needed a <strong>gatekeeper;</strong></p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>a person who can make sure that everyone is participating and getting along in an orderly fashion. </span></span></code></pre></div><p>There were some interesting examples from the trainers which led to some thought-provoking advice, for example;</p> <blockquote> <p><strong><em>“Hands off my keyboard”</em></strong></p> </blockquote> <p>As a trainer, when asked for help, there is a tendency to grab the keyboard to “show” the students how to work out the task at hand. In doing so, we inadvertently diminish their autonomy, reduce their confidence and invade their personal space.</p> <p>Other practical advice to display an open and inclusive space include introducing our pronouns at the start of the session. In doing so, the participants become aware that this is an inclusive environment where they are encouraged to express themselves.</p> <p>We also discussed breaks during sessions, such as;</p> <p><strong>“Bio breaks”</strong>, short breaks of 5-10 minutes to allow participants time to go to the bathroom, drink water, and stretch to prevent people from taking breaks at different times and miss out on something.</p> <p><strong>“Brain Breaks”</strong>, a mental break of 1-3 minutes each hour of the session, to help participants to re-energize, re-focus and relax, allowing people to reflect or clear their minds.</p> <h2 id="since-we-are-focused-on-computational-teaching-it-didnt-go-amiss-to-include-advice-on-technological-solutions-to-facilitate-training-sessions-while-catering-for-different-abilities-and-needs">Since we are focused on computational teaching, it didn’t go amiss to include advice on technological solutions to facilitate training sessions while catering for different abilities and needs.</h2> <p>Check out the list of Do&rsquo;s and Don&rsquo;ts in computational training and please feel free to share your tips and advice on <a href="https://github.com/selgebali/CCMcr19_dos">GitHub</a>.</p> <h4 id="sara-el-gebali">Sara El-Gebali</h4> <p>Email: <a href="mailto:selgebali@gmail.com">selgebali@gmail.com</a> Twitter: @yalahowy GitHub: @selgebali</p>https://www.open-bio.org/2019/07/16/biopython-1-74-released/Tue, 16 Jul 2019 19:39:56 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2019/07/16/biopython-1-74-released/<p>Dear Biopythoneers,</p> <p>Biopython 1.74 has been released and is available from our <a href="https://biopython.org/wiki/Download">website</a> and <a href="https://pypi.python.org/pypi/biopython/1.74">PyPI</a>.</p> <p>This release of Biopython supports Python 2.7, 3.4, 3.5, 3.6 and 3.7. However, it will be the last release to support Python 3.4 which is now at end-of-life. It has also been tested on PyPy2.7 v6.0.0 and PyPy3.5 v6.0.0.</p> <p>(Please note we will be dropping support for Python 2.7 in early 2020.)</p> <p>Over half our code is now explicitly available under either our original &ldquo;Biopython License Agreement&rdquo;, or the very similar but more commonly used &ldquo;3-Clause BSD License&rdquo;. See the <code>LICENSE.rst</code> file for more details.</p> <p>Our core sequence objects ( <code>Seq</code>, <code>UnknownSeq</code>, and <code>MutableSeq</code>) now have a string-like <code>.join()</code> method.</p> <p>The NCBI now allows longer accessions in the GenBank file LOCUS line, meaning the fields may not always follow the historical column based positions. We no longer give a warning when parsing these. We now allow writing such files (although with a warning as support for reading them is not yet widespread).</p> <p>Support for the <code>mysqlclient</code> package, a fork of MySQLdb, has been added.</p> <p>We now capture the IDcode field from PDB Header records.</p> <p><code>Bio.pairwise2</code>&rsquo;s pretty-print output from <code>format_alignment</code> has been optimized for local alignments: If they do not consist of the whole sequences, only the aligned section of the sequences are shown, together with the start positions of the sequences (in 1-based notation). Alignments of lists will now also be prettily printed.</p> <p><code>Bio.SearchIO</code> now supports parsing the text output of the HHsuite protein sequence search tool. The format name is <code>hhsuite2-text</code> and <code>hhsuite3-text</code>, for versions 2 and 3 of HHsuite, respectively.</p> <p><code>Bio.SearchIO</code> HSP objects has a new attribute called <code>output_index</code>. This attribute is meant for capturing the order by which the HSP were output in the parsed file and is set with a default value of -1 for all HSP objects. It is also used for sorting the output of <code>QueryResult.hsps</code>.</p> <p><code>Bio.SeqIO.AbiIO</code> has been updated to preserve bytes value when parsing. The goal of this change is make the parser more robust by being able to extract string-values that are not utf-8-encoded. This affects all tag values, except for ID and description values, where they need to be extracted as strings to conform to the <code>SeqRecord</code> interface. In this case, the parser will attempt to decode using <code>utf-8</code> and fall back to the system encoding if that fails. This change affects Python 3 only.</p> <p><code>Bio.motifs.mast</code> has been updated to parse XML output files from MAST over the plain-text output file. The goal of this change is to parse a more structured data source with minimal loss of functionality upon future MAST releases. Class structure remains the same plus an additional attribute <code>Record.strand_handling</code> required for diagram parsing.</p> <p><code>Bio.Entrez</code> now automatically retries HTTP requests on failure. The maximum number of tries and the sleep between them can be configured by changing <code>Bio.Entrez.max_tries</code> and <code>Bio.Entrez.sleep_between_tries</code>. (The defaults are 3 tries and 15 seconds, respectively.)</p> <p>All tests using the older print-and-compare approach have been replaced by unit tests following Python&rsquo;s standard testing framework.</p> <p>On the documentation side, all the public modules, classes, methods and functions now have docstrings (built in help strings). In addition to displaying the <a href="https://biopython.org/DIST/docs/api/">Biopython API documentation via epydoc</a>, we now also have the <a href="https://biopython.org/docs/1.74/api/">Biopython API documentation via Sphinx</a> (which we hope to make the default in future). Furthermore, the PDF version of the <em>Biopython Tutorial and Cookbook</em> now uses syntax coloring for code snippets.</p> <p>Additionally, a number of small bugs and typos have been fixed with further additions to the test suite, and there has been further work to follow the Python PEP8, PEP257 and best practice standard coding style.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Andrey Raspopov (first contribution)</li> <li>Antony Lee</li> <li>Benjamin Rowell (first contribution)</li> <li>Bernhard Thiel</li> <li>Brandon Invergo</li> <li>Catherine Lesuisse</li> <li>Chris Rands</li> <li>Deepak Khatri (first contribution)</li> <li>Gert Hulselmans</li> <li>Jared Andrews</li> <li>Jens Thomas (first contribution)</li> <li>Konstantin Vdovkin</li> <li>Lenna Peterson</li> <li>Mark Amery</li> <li>Markus Piotrowski</li> <li>Micky Yun Chan (first contribution)</li> <li>Nick Negretti</li> <li>Peter Cock</li> <li>Peter Kerpedjiev</li> <li>Ralf Stephan</li> <li>Rob Miller</li> <li>Sergio Valqui</li> <li>Victor Lin</li> <li>Wibowo &lsquo;Bow&rsquo; Arindrarto</li> <li>Zheng Ruan</li> </ul> <p>For reference, checksums:</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>$ md5sum biopython-1.74* </span></span><span style="display:flex;"><span> 808a8cc83ef7ae8328de47112a9619c9 biopython-1.74-cp27-cp27m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> bc71b115d62fa0505b05dcb8d51ebbb3 biopython-1.74-cp27-cp27m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> eb9b68d29187208688f3763d7f9b4443 biopython-1.74-cp27-cp27m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> e060e2971cb64488392690f2b49a894a biopython-1.74-cp27-cp27mu-manylinux1_i686.whl </span></span><span style="display:flex;"><span> 69e2b9aea866248dcb250b0d4749347c biopython-1.74-cp27-cp27mu-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> 301964b516d9a1af29db36c45e97857c biopython-1.74-cp27-cp27m-win32.whl </span></span><span style="display:flex;"><span> 72549961e56ba7c00ddf5aa4d4a2c4b7 biopython-1.74-cp27-cp27m-win_amd64.whl </span></span><span style="display:flex;"><span> 7545b99fe59e820b3e5343463df9bf61 biopython-1.74-cp34-cp34m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> a18c82789358cd3a6cf854750bbf9216 biopython-1.74-cp34-cp34m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> 33f5c75fe0fd63bba49afb19077a6067 biopython-1.74-cp34-cp34m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> 2d42a3e23b976a4a7db837b9d2782df1 biopython-1.74-cp34-cp34m-win32.whl </span></span><span style="display:flex;"><span> 9a74dbfa0c81848ce107ad3c169ce1d3 biopython-1.74-cp34-cp34m-win_amd64.whl </span></span><span style="display:flex;"><span> 6fc5cce9f94e5cac1aa4b57774e8626b biopython-1.74-cp35-cp35m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> 7c8e4473a474c05e39d70d8106dbd641 biopython-1.74-cp35-cp35m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> dc9710022e6409590fc99bc82309cd8d biopython-1.74-cp35-cp35m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> fe2623ea21ca2e9f057eae333d0ae386 biopython-1.74-cp35-cp35m-win32.whl </span></span><span style="display:flex;"><span> b4b59bbf517e42c8e1abfbe7af2a6893 biopython-1.74-cp35-cp35m-win_amd64.whl </span></span><span style="display:flex;"><span> a28eaf891cd04af42ea6391477c968d8 biopython-1.74-cp36-cp36m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> 74761f292187cfc06166107230d94dcd biopython-1.74-cp36-cp36m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> 62e7696d4597d7b7ff8bbf157191c284 biopython-1.74-cp36-cp36m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> 419f489831ec20aa1e11384d2991676c biopython-1.74-cp36-cp36m-win32.whl </span></span><span style="display:flex;"><span> 743a888661c48b66d41de2e6c04890d5 biopython-1.74-cp36-cp36m-win_amd64.whl </span></span><span style="display:flex;"><span> 025d4a914ad515b0181bdb0f8b1e8a2e biopython-1.74-cp37-cp37m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> db5ee8837a887188bcef09f57b5bf12f biopython-1.74-cp37-cp37m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> f7602a46d3e2e3302f99437739652727 biopython-1.74-cp37-cp37m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> 20075d6abfbdb011460829f624de0832 biopython-1.74-cp37-cp37m-win32.whl </span></span><span style="display:flex;"><span> ffdd7986cb63dedf8daa4fb78140bbac biopython-1.74-cp37-cp37m-win_amd64.whl </span></span><span style="display:flex;"><span> cead2bfe9e7be45267eba00635f68d5c biopython-1.74.tar.gz </span></span><span style="display:flex;"><span> ff21159f333f433f3fa5a01a791cf717 biopython-1.74.zip </span></span></code></pre></div><div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>$ sha256sum biopython-1.74* </span></span><span style="display:flex;"><span> 6182f8c17c81aa40987b018e6241719137e463f5bb263c423db6180d118d3a03 biopython-1.74-cp27-cp27m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> 7103f3dd3cef9f6ae52c0c3275ecb65121f3935b90d25c5e149ce62f684fbaf2 biopython-1.74-cp27-cp27m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> bb302ad68a133ed3ae26efa0a0c82a0905c8b9b85a70fa6626611a882a65ec61 biopython-1.74-cp27-cp27m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> 77145b88a74c89f752db2ed11f64737161cc337c9e520e3853c945bd1d9866e6 biopython-1.74-cp27-cp27mu-manylinux1_i686.whl </span></span><span style="display:flex;"><span> 022909d10bbdfbc70eba6ea1c06ff573444e26e40ef0899025fb269898604b16 biopython-1.74-cp27-cp27mu-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> 540f9df15e11f091e2d92959b891d2001bb59660ca806d51ca30d76dab60d39e biopython-1.74-cp27-cp27m-win32.whl </span></span><span style="display:flex;"><span> 36c35d93d16c9270303bfc755d2364171a1aaebd75f3bfa97179712a3ac09e2d biopython-1.74-cp27-cp27m-win_amd64.whl </span></span><span style="display:flex;"><span> d6a310fab78e11dba51b55a2b194a79128d202584127e17952f7f64b52da83e2 biopython-1.74-cp34-cp34m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> d3bf43ea45859bec05e8496c39dbd614c75520a832da20d826fdbd7e83105414 biopython-1.74-cp34-cp34m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> 8b7a3edd0dcc9eae3020849ad6110c721399f2c8dd71e54317dcc50035f9ebf9 biopython-1.74-cp34-cp34m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> 32c50dd9450ac780d640baa212ecde22fcc98dc0de472b40296968df2385c824 biopython-1.74-cp34-cp34m-win32.whl </span></span><span style="display:flex;"><span> 015b79eea59bb5ccf7abef2ab17a813540c5c1969a8def2148fe3d529ff405a3 biopython-1.74-cp34-cp34m-win_amd64.whl </span></span><span style="display:flex;"><span> 1324bd2f6ea1dbad748085875d4c206f08748bb7848355f365d31fcd771dfa75 biopython-1.74-cp35-cp35m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> 6d9a39f295d97ed953a48c1cde635b35205ed25034015238776dbd2a8afbb2a7 biopython-1.74-cp35-cp35m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> 273c524550aaad3284edbdacecdf66cfd880dac580a5f6c5f80a9925a70144fb biopython-1.74-cp35-cp35m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> e6cc6e725a5fb628d41ed675bb74aa5eb03763e1ccd3111d0f73f739c7263ab4 biopython-1.74-cp35-cp35m-win32.whl </span></span><span style="display:flex;"><span> aa07bcf7def1c270c1fc1bab25f72a34f1ba24ab0a2d680f0a8466b39a2a7660 biopython-1.74-cp35-cp35m-win_amd64.whl </span></span><span style="display:flex;"><span> efee2f77cef1b65a76fe27af83c05774329b481c2da71d0580fcbcf92d6e9988 biopython-1.74-cp36-cp36m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> f50ee861a67e96488d21bc210ea72250df8cb7578351366f52c3904b841b5fbe biopython-1.74-cp36-cp36m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> fa8ed2c3fec5dc45f9b750bd5da386f82cddb7944b456bfd0472106050efa397 biopython-1.74-cp36-cp36m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> 7c32c37b20843e1d22e76c889f1733097e27996d1ec0fe54d84e5f737c9ff65e biopython-1.74-cp36-cp36m-win32.whl </span></span><span style="display:flex;"><span> 046510af3cbaaf822e7451f0772e3e3f327916edbfd1f34798e6b8cbf60e8aa3 biopython-1.74-cp36-cp36m-win_amd64.whl </span></span><span style="display:flex;"><span> 67144db2defb3b49d505c7c4c676ca80b3451a0764f507b930b86031b7ebde5c biopython-1.74-cp37-cp37m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> b8cdfaf2963b7ef24497aa82e60bfc86267989f32a49b4edd4a67aba75202834 biopython-1.74-cp37-cp37m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> a117596b366e2226e2bf0adaf87f32cda495357c398b1b2ca2ada9f54c386718 biopython-1.74-cp37-cp37m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> 3a802aba32b64aee9c3b92d8b5d50aa3d0a95c8188b69a78a2cbc292578dae08 biopython-1.74-cp37-cp37m-win32.whl </span></span><span style="display:flex;"><span> ca627475233f698ede17b5adb169ed10b44ab4dc3a48d71069d7ab0086bdbc1c biopython-1.74-cp37-cp37m-win_amd64.whl </span></span><span style="display:flex;"><span> 25152c1be2c9205bf80901fc49adf2c2efff49f0dddbcf6e6b2ce31dfa6590c0 biopython-1.74.tar.gz </span></span><span style="display:flex;"><span> 546dd36c5ba18696d6b4673d8f68c01bd27b016f2e3fdefb5ff848f646a91ba4 biopython-1.74.zip </span></span></code></pre></div>https://www.open-bio.org/2019/02/22/google-summer-of-code-2018-wrap-up/Fri, 22 Feb 2019 17:19:42 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2019/02/22/google-summer-of-code-2018-wrap-up/<p>We have recently applied to Google for the OBF to be part of the Google Summer of Code 2019 programme, again with Kai Blin and Michael Crusoe as joint administrators. Last year, <a href="https://summerofcode.withgoogle.com/archive/2018/organizations/5813329234755584/">OBF GSoC 2018</a>, was another good year with five students successfully completing their projects:</p> <ul> <li>Synchon Mandal (mentor Moritz Beber) &ldquo;Adding methods to cobrapy for improved constraint-based metabolic modelling.&rdquo; ( <a href="https://medium.com/@synchon_mandal/my-journey-to-gsoc-18-d46b59c3d4e">first blog bost</a>; <a href="https://medium.com/@synchon_mandal/gsoc-2018-with-open-bioinformatics-foundation-dc201bf945b9">final report</a>)</li> <li>Sophia Mersmann (mentors Oliver Alka, Julianus Pfeuffer, and Timo Sachsenberg) &ldquo;Improve Posterior Error Probability Estimation For Peptide Search Engine Results&rdquo; <a href="https://sophiamersmann.github.io/">(blog posts</a>; <a href="https://sophiamersmann.github.io/2018/08/08/final-report/">final report</a>)</li> <li>Edgar Garriga Nogales (mentors Paolo Di Tommaso, Michael R. Crusoe, and Stian Soiland-Reyes) &ldquo;Implement the support for Research Object specification into Nextflow framework&rdquo; ( <a href="https://github.com/edgano/nextflow/tree/663a933db47a246cae35703892bebd4b03e97b5b/subprojects/nxf-prov">repository</a>; <a href="http://edgargarriga.com/">homepage</a>; <a href="https://github.com/edgano/nextflow/tree/663a933db47a246cae35703892bebd4b03e97b5b/subprojects/nxf-prov">final report</a>).</li> <li>Sarthak Sehgal (mentors Yo Yehudi, Dennis Schwartz, and Rowland Mosbergen) &ldquo;Frontend Website Student Project for BioJS&rdquo; ( <a href="https://github.com/biojs/biojs-frontend">repository</a>; <a href="http://blog.biojs.net/tags/#frontend">blog posts</a>; <a href="http://blog.biojs.net/2018-08-12-final-report-frontend/">final report</a>).</li> <li>Megh Thakkar (mentors Yo Yehudi, Dennis Schwartz, and Rowland Mosbergen) &ldquo;Backend Website Student Project for BioJS&rdquo; ( <a href="https://github.com/biojs/biojs-backend">repository</a>; <a href="http://blog.biojs.net/tags/#backend">blog posts</a>; <a href="http://blog.biojs.net/2018-08-12-final-report-backend/">final report</a>).</li> </ul> <p>In some cases there isn&rsquo;t a single code repository to link to, rather their work included pull requests to the main project etc.</p> <p>Thank you to all our volunteer GSoC administrators and mentors - and of course thank you to the students - we hope you&rsquo;ll continue to work in bioinformatics and/or open source.</p>https://www.open-bio.org/2018/12/18/biopython-1-73-released/Tue, 18 Dec 2018 16:58:41 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/12/18/biopython-1-73-released/<p>Dear Biopythoneers,</p> <p>Biopython 1.73 has been released and is available from our <a href="https://biopython.org/wiki/Download">website</a> and <a href="https://pypi.python.org/pypi/biopython/1.73">PyPI</a>.</p> <p>This release of Biopython supports Python 2.7, 3.4, 3.5 and 3.6. It has also been tested on PyPy2.7 v6.0.0 and PyPy3.5 v6.0.0.</p> <p>As in recent releases, more of our code is now explicitly available under either our original &quot; <em>Biopython License Agreement&quot;</em>, or the very similar but more commonly used <em>&ldquo;3-Clause BSD License&rdquo;</em>.  See the <a href="https://github.com/biopython/biopython/blob/master/LICENSE.rst">LICENSE.rst</a> file for more details.</p> <p>The dictionary-like indexing in <code>Bio.SeqIO</code> and <code>Bio.SearchIO</code> will now explicitly preserve record order to match a behaviour change in the Python standard dict object. This means looping over the index will load the records in the on-disk order, which will be much faster (previously it would be effectively at random, based on the key hash sorting).</p> <p>The &ldquo;grant&rdquo; matrix in Bio.SubsMat.MatrixInfo has been replaced as our original values taken from Gerhard Vogt&rsquo;s old webpages at EMBL Heidelberg were discovered to be in error. The new values have been transformed following Vogt&rsquo;s approach, taking the global maximum 215 minus the similarity scores from the original paper Grantham (1974), to give a distance measure.</p> <p>Double-quote characters in GenBank feature qualifier values in <code>Bio.SeqIO</code> are now escaped as per the NCBI standard. Improperly escaped values trigger a warning on parsing.</p> <p>There is a new command line wrapper for the BWA-MEM sequence mapper.</p> <p>The string-based FASTA parsers in <code>Bio.SeqIO.FastaIO</code> have been optimised, which also speeds up parsing FASTA files using <code>Bio.SeqIO.parse()</code>.</p> <p>Additionally, a number of small bugs and typos have been fixed with further additions to the test suite, and there has been further work to follow the Python PEP8, PEP257 and best practice standard coding style.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Alona Levy-Jurgenson (first contribution)</li> <li>Ariel Aptekmann</li> <li>Brandon Invergo</li> <li>Catherine Lesuisse</li> <li>Chris Rands</li> <li>Darcy Mason (first contribution)</li> <li>Devang Thakkar (first contribution)</li> <li>Ivan Antonov (first contribution)</li> <li>Jeremy LaBarage (first contribution)</li> <li>Juraj Szász (first contribution)</li> <li>Kai Blin</li> <li>Konstantin Vdovkin (first contribution)</li> <li>Manuel Nuno Melo (first contribution)</li> <li>Maximilian Greil</li> <li>Nick Negretti (first contribution)</li> <li>Peter Cock</li> <li>Rona Costello (first contribution)</li> <li>Spencer Bliven</li> <li>Wibowo &lsquo;Bow&rsquo; Arindrarto</li> <li>Yi Hsiao (first contribution)</li> </ul> <p>For reference, checksums:</p> <p><code>$ md5sum biopython-1.73* 9bab1776b3f63cb2a81715e78abfb6e0 biopython-1.73-cp27-cp27m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl a531f656ecae854adf1fc6021735c2a9 biopython-1.73-cp27-cp27m-manylinux1_i686.whl 27f5179f2493408d33e5322690f1bb7a biopython-1.73-cp27-cp27m-manylinux1_x86_64.whl 41fdb1f257cdcd030a468e7339a6c6ab biopython-1.73-cp27-cp27mu-manylinux1_i686.whl bf23d2daae5c72c2d84058bce3acd7a2 biopython-1.73-cp27-cp27mu-manylinux1_x86_64.whl d3cab98752b83cef121b7a1e8b81853c biopython-1.73-cp27-cp27m-win32.whl 178be72d7b294a2a15c92630bbee2a81 biopython-1.73-cp27-cp27m-win_amd64.whl 32fc6184cbf21faca0776251570b2c58 biopython-1.73-cp34-cp34m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl 5c78b8210de0b511c208facf7325c7e6 biopython-1.73-cp34-cp34m-manylinux1_i686.whl ae414b4666900567579cc92df4223521 biopython-1.73-cp34-cp34m-manylinux1_x86_64.whl 1b0d7ba1b4c097b318213431d9b6b99e biopython-1.73-cp34-cp34m-win32.whl 04a91b6ea826596b0c8b643b743d176f biopython-1.73-cp34-cp34m-win_amd64.whl a8ecaa7bf30fd912536881228e754664 biopython-1.73-cp35-cp35m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl 0676a634a73e049903a4bc36e3b60fc3 biopython-1.73-cp35-cp35m-manylinux1_i686.whl 6d4ebb6131a611a71816b0208747de55 biopython-1.73-cp35-cp35m-manylinux1_x86_64.whl 65165d6551e43bdc18e0912935f9c7fd biopython-1.73-cp35-cp35m-win32.whl 24c6352a143ea28c47bff5da754f0af9 biopython-1.73-cp35-cp35m-win_amd64.whl d11a2c7ba85a9927815fb9b6dfd9a0ac biopython-1.73-cp36-cp36m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl 8898e77221359b4d4280e42a53bfbc52 biopython-1.73-cp36-cp36m-manylinux1_i686.whl fb8a38c943a9e80492ddb657e9d330a5 biopython-1.73-cp36-cp36m-manylinux1_x86_64.whl 1f49d1a5b492639008dd674b83a8bcb7 biopython-1.73-cp36-cp36m-win32.whl f0dde83e1a7c27a107e6aeb253f29f08 biopython-1.73-cp36-cp36m-win_amd64.whl e082d026d3bb894838e389f159a8362b biopython-1.73-cp37-cp37m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl 0db98f888700a7e119f39f136687c3d1 biopython-1.73-cp37-cp37m-manylinux1_i686.whl c92184fad3be8c8ba3cc3e8816603dc5 biopython-1.73-cp37-cp37m-manylinux1_x86_64.whl 58c58f52d514bd9a86df01da1db0d804 biopython-1.73-cp37-cp37m-win32.whl e32acd6a4a2c703ee5ff34cd62f83124 biopython-1.73-cp37-cp37m-win_amd64.whl d1d2e6154c2c89d6bb0e77f4a3578686 biopython-1.73.tar.gz 478d71daf63e9b57775fbd5aaa8f48f1 biopython-1.73.zip</code> <code>$ sha256sum biopython-1.73* c43a47ad3397336aa7af5a0bb5ebec91aa2ae328b71421e550cf7e7f80d00f69 biopython-1.73-cp27-cp27m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl 0302d5be80850fbaa93789ab516d189c9400755901cfe566a324e8fea10ed39b biopython-1.73-cp27-cp27m-manylinux1_i686.whl e5b5666724cab7983aebeb593e52dd276ff9fdabb3669d57db8b5ea303a097a5 biopython-1.73-cp27-cp27m-manylinux1_x86_64.whl 21723d79a1d15e99c823b440dd37176259dffa686e2a015919ad255d89238491 biopython-1.73-cp27-cp27mu-manylinux1_i686.whl 85d53b91406aacfef673fb3cf24873d978654fa49d52b5ab4d9c3b0d06b003d6 biopython-1.73-cp27-cp27mu-manylinux1_x86_64.whl c5beb53e2d5a5a573baaaa449a32d3adfb3d03bd7752adbcb20a62d6e8041e03 biopython-1.73-cp27-cp27m-win32.whl add575d5b81eec95381a53ca8c042e9de9e506b24734ec773690247d997eaa69 biopython-1.73-cp27-cp27m-win_amd64.whl 59610b1639a7d9c1f36a5398e748c044c21f4285230fa79fcea2cafe835f9366 biopython-1.73-cp34-cp34m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl 1c4b55412c12b246b948c3bbb30e60a7b075da9770449371a731ac9987849381 biopython-1.73-cp34-cp34m-manylinux1_i686.whl aed261f47f72d63292fdf4c81197fdbc150094a34e10176647a932c83e179db9 biopython-1.73-cp34-cp34m-manylinux1_x86_64.whl 3cc401c15a85829eb6ae01babb02fbe7828548709b4dcb6d5149e94d5173ed7c biopython-1.73-cp34-cp34m-win32.whl f49558bea021cc5243e50efb38d545842153cde276e14879d6d63222065c683d biopython-1.73-cp34-cp34m-win_amd64.whl a149ea816f21ef72e1b4e6f538b13141584bdc531f864c5f1eb8b8feed71ba06 biopython-1.73-cp35-cp35m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl e7a03ae81b5507b3a668f81a58351c065fa6d8a0b77f772e183eb284c1cc4619 biopython-1.73-cp35-cp35m-manylinux1_i686.whl fce8051b05d62d7d0ff7af0999f6874bd9af17f0613e6c8664ac20c93215345a biopython-1.73-cp35-cp35m-manylinux1_x86_64.whl 99e6f78317c68b27a8b406c5595364005d43fee67f3b8ae20c3332588999442f biopython-1.73-cp35-cp35m-win32.whl 839882c1929476538f9872e7fe6617c6fbcd65989483254817effbc388feead1 biopython-1.73-cp35-cp35m-win_amd64.whl 164b9958d1714f318015900f2689fcc08859f76b11484e8f91f1f29acb4b7465 biopython-1.73-cp36-cp36m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl d120346e2eed46beaf1d0771826a18cee7c3155cc8c0dafc6ffffc74ac49e8fc biopython-1.73-cp36-cp36m-manylinux1_i686.whl 92c0940c5c2a76b559538a4eb1fc0277d3e960209c537d5b74632fa87a51a810 biopython-1.73-cp36-cp36m-manylinux1_x86_64.whl 5542f847a860b90e742a1be8a9807aa57accacd2bccfb07b3f6511f85201af19 biopython-1.73-cp36-cp36m-win32.whl ef69ed6acf7bee26c530e40a768d060f46eef228d06aa2ea89439d3c54759bd8 biopython-1.73-cp36-cp36m-win_amd64.whl cfb44ba6cdfb1dbfc05b7e46f26286b37d35b2bb847868c9088e9b67060fd7be biopython-1.73-cp37-cp37m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl ede4e4335828a780dc2096fd0443c45efb3f8fcac741e544454997b978ad3cf3 biopython-1.73-cp37-cp37m-manylinux1_i686.whl 26f8ae8ddf06c85dab12f5aaff538593c7cec69102bb4ad968b3eb40a0477bf8 biopython-1.73-cp37-cp37m-manylinux1_x86_64.whl 93d79520586b48a2a77bec3a0623871b656c45dbb83c9b6834540f0a7232478e biopython-1.73-cp37-cp37m-win32.whl 0fa9346c8ec144da12a556861090cfe5fbb6ecd89418d6358047b90def48e032 biopython-1.73-cp37-cp37m-win_amd64.whl 70c5cc27dc61c23d18bb33b6d38d70edc4b926033aea3b7434737c731c94a5e0 biopython-1.73.tar.gz ade6ebfd01d58e7937a53f16e2d87e17509ec8335fe2573f39bdb7495e7e3d2b biopython-1.73.zip</code></p>https://www.open-bio.org/2018/08/29/the-color-of-bioinformatics/Wed, 29 Aug 2018 10:33:49 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/08/29/the-color-of-bioinformatics/<p><em>This is a guest blog post from Tendai Mutangadura, who was supported by the ongoing <a href="https://github.com/OBF/obf-docs/blob/master/Travel_fellowships.md">Open Bioinformatics Foundation travel fellowship</a> program to attend the <a href="https://gccbosc2018.sched.com/">GCCBOSC 2018</a> meeting in Portland, June 2018. The OBF’s Travel Fellowship program continues to help open source bioinformatics software developers with funding to attend conferences or workshops. This was one of <a href="https://news.open-bio.org/2018/05/25/travel-fellowships-april-2018/">three awards from our April 2018 travel fellowships call</a>. Our August call recently closed, the current call closes 15 December 2018, you might want to apply?</em></p> <p>When I was selected as one of 3 recipients of the April 2018 OBF Travel Fellowships, I wanted this to signify a turning point in my career. I expected to meet and interact with many great minds in open science and bioinformatics, and the <a href="https://gccbosc2018.sched.com/">GCC-BOSC 2018</a> meeting in beautiful Portland exceeded my expectations. Because I was travelling light and had been to Portland once before, I chose to use public transport from PDX to get to Reed College, the meeting venue. This afforded me a mini tour of Portland before getting to the serious but fun business of the meeting. When I stepped off the Reed College bus stop, I flagged down the first person I saw to ask for directions to the registration venue, and this person was none other than Anton, one of the scientists instrumental in the development of the <a href="https://usegalaxy.org/">Galaxy project</a>. Great start. As we chatted en route to the registration place, I took the opportunity to brag to him that I had recently figured out the causal mutation associated with a neurodegenerative disease in one of our whole-genome-sequenced dogs using the web-based <a href="https://usegalaxy.org/">Galaxy platform</a>.</p> <p>I attended as many training sessions related to Galaxy on Day 1 of training as I could. I have been a Galaxy platform user for &gt;3 years and had previously attended the GCC 2016, so it was great to meet new and old acquaintances this time round. I even had the opportunity to get help with aspects of my <a href="https://jetstream-cloud.org/support/index.php">Jetstream</a> account virtual machines during one of the two CollaborationFest days that I attended. I found the CollaborationFest very useful in making new contacts and discussing potential future collaborations.</p> <p>On Day 2 of Training, the highlights of my training, based my bioinformatics needs, included a 2.5 hour <a href="https://software.broadinstitute.org/gatk/">GATK</a> training session and the <a href="https://bcbio-nextgen.readthedocs.io/en/latest/contents/pipelines.html">bcbio</a> workshop. In the latter, Brad Chapman, <a href="https://www.youtube.com/watch?v=ukWhAetvNKE">starring here</a>, talked about and demonstrated how communities can work together to make giant strides in developing robust open source software pipelines and making these freely accessible to anyone, everyone, anywhere. For someone like me, for whom having access to computing resources and setting aside the time to focus on developing or tweaking code as part of my day job can sometimes be an uphill struggle, the bcbio workshop was a godsend. Bcbio allows me to do my day job duties and do bioinformatics too. After the meeting, I immediately contacted one of my XSEDE Extended Collaborative Support Services ( <a href="https://portal.xsede.org/ecss">ECSS</a>) team members, Phil Blood, to discuss the possibility of putting together a species agnostic variant-calling pipeline. I have already started this project using my <a href="https://www.xsede.org/">XSEDE</a> start-up grant computing resources allocation on <a href="https://www.psc.edu/bridges">Bridges</a>, at the Pittsburgh Supercomputing Center ( <a href="https://www.psc.edu/">PSC</a>). So far, I have been off to a good start. For those who may not be aware of the many great free computing resources out there, such resources exist, as I have alluded to above, for anyone to take advantage of.</p> <p>Now, a light-hearted reference to a serious (according to me), but common observation at conferences such as but definitely not limited to GCC-BOSC: the lack of diversity of attendees. This is what prompted me to title my blog post the way I did. My first answer was (metaphorically speaking) that the color of bioinformatics <em>should</em> be ‘rainbow’. But when I googled ‘rainbow colors’ it occurred to me that the colors black and white are not part of the rainbow. I also refreshed my rusty optical physics and got explanations why this is the case. Now, to get back on track, would it not be wonderful if more people of color were involved in this bioinformatics revolution? What can be done to redress this current state of affairs? Thumbs up to the OBF for recognizing and doing something about this lack of diversity by creating the OBF Travel Fellowship! For my part, when and if I complete any pipeline(s) based on bcbio code, I plan to publish a collection of such pipelines online as self-paced tutorials (the website will go live soon) in a very user-friendly format targeted to those who are command line challenged, from any community, to encourage them to get started in bioinformatics analyses, or at least analyze their own data without buying expensive commercial packages. This would be my way, albeit at very small scale, of democratizing bioinformatics. One of the advantages of involving people with as diverse backgrounds as possible with basic training in bioinformatics and genomics is that this may help <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4354806/">reduce mistrusts</a> linked to unfortunate historical incidents such as the Tuskegee experiments, not only for countries like the US but anywhere around the world where similar types of mistrust may exist.</p>https://www.open-bio.org/2018/08/18/city-of-roses-they-call-it-portland-oregon-usa/Sat, 18 Aug 2018 15:27:34 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/08/18/city-of-roses-they-call-it-portland-oregon-usa/<p>How should I start describing the fruitful experience in this amazing city&hellip; First time ever in Portland, second time attending BOSC&hellip; I knew I was signing up for a great time but did not know much about the uncanny beauty of this picturesque city.</p> <p>First of all, I would like to thank the Open Bioinformatics Foundation (OBF) for providing partial funding to support my travel expenses (though an <a href="https://www.open-bio.org/2018/05/25/travel-fellowships-april-2018/">OBF Travel Fellowship award</a>). I would also like to thank my PhD supervisors Andrew Lonie and Richard O. Sinnott for the remaining expenditure.</p> <p>I had written a very detailed blog post of my experience in <a href="https://news.open-bio.org/2017/11/21/bosc-2017-prague-land-of-stories/">BOSC 2017</a>. The experience was a bit different this time as BOSC was organised in conjunction with Galaxy Community Conference(GCC) this year, unlike previous all times when BOSC was held with ISMB. On a lighter note, the most positive difference (as compared to last year) was the unlimited supply of coffee/tea in the <a href="https://en.wikipedia.org/wiki/Coffee_in_Portland,_Oregon">coffee town</a> throughout the conference to keep the morale high.  The other difference was the budget-friendly registration costs of the conference this year. The cheaper accommodation options were available in the hostels of <a href="https://www.reed.edu/">Reed College</a>, the beautiful and lush green venue for the conference.</p> <p><img src="https://news.open-bio.org/wp-content/uploads/2018/08/WhatsApp-Image-2018-08-18-at-9.02.55-PM1-300x169.jpeg" alt=""></p> <p>The conference was divided into three cores:</p> <ul> <li><strong>Training days:</strong> The first two days June 25th and June 26th were focused on training sessions running in parallel covering various bioinformatics topics such as Galaxy introduction, RNA-seq data analysis (Galaxy and bcbio), Data carpentry workshop, Conda-Containers, Workflow Definition Language( WDL) and Common Workflow Language (CWL) introduction.</li> <li><strong>Conference days:</strong> The next two days June 27th and June 28th were dedicated to parallel sessions of Galaxy and BOSC talks taking place in two different venues with combined keynote speeches.</li> <li><strong>Core Cofest days:</strong> Unlike last year, the intense collaborative hacking sessions were after the conference on June 29th and 30th.</li> <li><strong>Encore Cofest days:</strong> July 1st and 2nd also part of cofest but on a smaller scale with fewer participants.</li> </ul> <p>This year was special in one more aspect that I contributed in the reviewing process as part of the BOSC program committee.</p> <p><a href="https://twitter.com/farahzk03/status/1011658076900823040">https://twitter.com/farahzk03/status/1011658076900823040</a></p> <p>I have attended all 8 days of the conference beginning from the training all the way to end of the Encore cofest. My <a href="https://f1000research.com/posters/7-916">abstract</a> was accepted for a long talk (and by default for a poster) in BOSC so there was a bit of anxiety until I was done with my presentation on June 28th :). There were so many interesting parallel training sessions and it was quite a tough decision to choose which one to attend. I managed to attend few such as Conda and Containers, Common Workflow Language and Snakemake and Nextflow. During the CWL training session on June 26th, I volunteered to help with the session to answer questions during the training.</p> <p><a href="https://twitter.com/rvmngr/status/1011701337719857152">https://twitter.com/rvmngr/status/1011701337719857152</a></p> <p>Like last year, I decided to print my poster at the venue to save myself from the hassle of carrying it from one continent to the other. Keeping that in mind, I did the same this year. I got the poster printed from a local printing press <a href="https://www.minutemanteam.com/">Minuteman Press</a>. The staff was highly professional, talking over the phone, placing the order over the phone, sending poster via email and paying online saved me from having to visit the shop twice. They checked the poster, called again clarified few things to make sure things are appearing the way they should be. I would say overall the experience was pretty smooth and the print quality was also up to the mark. There were in total two poster sessions, each in the evening of the conference days. My poster was scheduled for the evening session on June 27th. I received the printed copy on the morning of 27th which I arranged on the assigned slot.</p> <p><a href="https://twitter.com/farahzk03/status/1012073266599489537">https://twitter.com/farahzk03/status/1012073266599489537</a></p> <p>The conference on June 27th  started with very informative and interesting keynote speech by Fernando Perez on &ldquo;Sustainable development of scientific open source tools: a view from Jupyter&rdquo;.</p> <p><a href="https://twitter.com/farahzk03/status/1012002955053027328">https://twitter.com/farahzk03/status/1012002955053027328</a></p> <p>I must admit I was not aware of the functionality of <a href="http://jupyter.org/">Jupyter notebooks</a> before this and how interactive these are supporting many scripting languages as including Python, R, Julia, and Scala. Fernando was of the view that computational hygiene should be a day to day practice.</p> <p><a href="https://twitter.com/farahzk03/status/1012013507942891522">https://twitter.com/farahzk03/status/1012013507942891522</a></p> <p>Followed by keynote was an interesting talk where four engineers collaborating remotely for the project &ldquo;FROG&rdquo;,  shared their experiences with the packaging technologies. One of the many lessons emphasized in the talk is <em>&quot;</em> The first <em>step to learn packaging technologies: read the manuals.&quot;</em></p> <p><a href="https://twitter.com/farahzk03/status/1012019611741577216">https://twitter.com/farahzk03/status/1012019611741577216</a></p> <p>An interesting talk in the evening session was given by Ravi K. Madduri on &ldquo;Reproducible big data science: A case study in continuous FAIRness in which he explained how they demonstrated reproducibility of real-life workflows using Galaxy, minids and BDBags to achieve interoperability in naming and identifier conventions. He emphasized that reproducibility requires patience and discipline but <em>&ldquo;Reproducibility is like brushing your teeth. Once you learnt it, it becomes</em> a habit <em>.&rdquo;</em></p> <p><a href="https://twitter.com/farahzk03/status/1012079639890546688">https://twitter.com/farahzk03/status/1012079639890546688</a></p> <p>Some other talks in this session were  Intermine 2.0 by Yo Yohudi,  NIH Data Commons Introduction by David Siedzik and Snakemake by Johannas Koster. I rushed from Vollum hall where BOSC talks were organized for the Poster presentation In Performing Arts Building. The poster session was very interactive and the audience enjoyed the tea/coffee walking around and asking the presenters about their work. I think the time went by very fast and we had to rush back for the Panel discussion in Vollum hall which I missed a bit because of the ongoing conversations at the poster venue,</p> <p><img src="https://news.open-bio.org/wp-content/uploads/2018/07/lots-of-people-at-poster-session-1-300x231.jpg" alt="Presenters and attendees mingle at the GCCBOSC 2018 poster/demo session"></p> <p>As I arrived late so could attend half of the panel discussion. The panel discussion was on a topic which is of my personal interest as I am working on Provenance of the Bioinformatic workflows. The topic of the discussion was &ldquo;Training and Documentation in Bioinformatics&rdquo; where Fernando Perez, Tracy K. Teal, Jason Williams and Berenice Batut were guests.</p> <p><a href="https://twitter.com/farahzk03/status/1012127092421455872">https://twitter.com/farahzk03/status/1012127092421455872</a></p> <p>Also, GigaScience has the coolest Game of Thrones-themed shirts as always :D I got my hands on one last year but this year I could not get one :(.</p> <p><a href="https://twitter.com/farahzk03/status/1012175720682905605">https://twitter.com/farahzk03/status/1012175720682905605</a></p> <p>After the panel discussion, now the time was to prepare for my talk the next morning. I was very anxious but also excited to present what I am passionate about. Michael R. Crusoe was patient to listen to me, very kind to help me with the preparation of the presentation and encouraging that it will all be good. I don&rsquo;t have a massive public speaking fear but the start is always the hardest.</p> <p>The highlight of June 28th for me was the presentation which was scheduled for the morning session at 11:40 am. It turned out to be better than I expected :). A huge sigh of relief and then I could really enjoy the rest of the talks without thinking about mine.</p> <p><a href="https://twitter.com/biocrusoe/status/1012394197121261568">https://twitter.com/biocrusoe/status/1012394197121261568</a></p> <p>My talk was about <a href="https://zenodo.org/record/1208478">CWLProv,</a> a format for the representation and automatic aggregation of workflow enactment, its results and provenance to promote interoperability and reproducibility of methods. The feedback from the live audience during and after the presentation and on twitter was very helpful and encouraging, one of the most outstanding characteristics of the BOSC community :).</p> <p><a href="https://twitter.com/yoyehudi/status/1012401483776577537">https://twitter.com/yoyehudi/status/1012401483776577537</a></p> <p><a href="https://twitter.com/farahzk03/status/1012479030979747841">https://twitter.com/farahzk03/status/1012479030979747841</a></p> <p>The day got better with many interesting talks such as celebrating that CWL, a project that was founded in 2014 during the discussions in BOSC2014 turned four years old :). It is exciting to see how much the standard has grown and influenced projects all around the globe with more than 20 participating organizations and many individual contributors. CWL is an epitome of &ldquo;Open Source-ness&rdquo; and Community-driven projects designed with continuous interaction with the community itself to build a standard for workflow definition which promotes interoperability, portability and reproducibility and resolves the heterogeneity issue in workflow domain.</p> <p><a href="https://twitter.com/yoyehudi/status/1012395134665703424">https://twitter.com/yoyehudi/status/1012395134665703424</a></p> <p>Another highlight is the provision of affordable daycare for the participants and encouraging participants from all backgrounds to participate. An example was Cristel Thomas presenting in Galaxy session with the youngest participant with her. That’s the example, this amazing event is set for the other conferences. Encouraging participation if you are eager, no matter what the circumstances are.</p> <p><a href="https://twitter.com/crstlthms/status/1012054388347555840">https://twitter.com/crstlthms/status/1012054388347555840</a></p> <p>The day ended with an open door BBQ conference dinner, the weather, the food, the mood everything was on point. The beauty of the lush green campus and artistic architecture is breathtaking, sad that I was not able to explore much beauty but whatever I saw and wherever I went was telling a story.</p> <p><a href="https://twitter.com/farahzk03/status/1012528947836276736">https://twitter.com/farahzk03/status/1012528947836276736</a></p> <p>A big improvement during Cofest was gender balance which was a bit alarming last year during code fest where only 3 female participants joined in total out of &gt;60 participants. This year the situation improved drastically because of the two communities doing it together. The venue was quite spacious and full of resources to accommodate more than 100 participants working on different projects.</p> <p><img src="https://news.open-bio.org/wp-content/uploads/2018/07/codefest-big-group-on-steps-300x200.jpg" alt=""></p> <p>Like always the regular updates from groups were spread throughout the day, in the morning, before lunch and at the end of the day. These update sessions keep you going and motivate you to push yourself for tangible outputs. I worked alongside Michael (CWL) and we refactored the implementation of CWLProv, improved the prototype implementation working continuously for four days of cofest.</p> <p><img src="https://news.open-bio.org/wp-content/uploads/2018/08/WhatsApp-Image-2018-08-18-at-9.02.53-PM-300x225.jpeg" alt=""></p> <p>I believe in collaborative science without caring about geographical scenarios but with a huge time difference, it does get tricky sometimes to work together on a project. These four days were breath of fresh air discussing long due issues face to face, getting instant help, contributing more efficiently and getting a Pull Request with <a href="https://github.com/common-workflow-language/cwltool/pull/676">338 commits merged into cwltool</a> :). That is the biggest highlight for my participation and I am sure it would have taken much longer if  I did not have this opportunity. I encourage everyone to participate in the code fest as it will increase your productivity 10x.</p> <p><a href="https://twitter.com/farahzk03/status/1016537277160275974">https://twitter.com/farahzk03/status/1016537277160275974</a></p> <p><em>P.S. Some other day, I will write about my experience with food, walks around the city, strolling on the river bank and the non-science talks.</em></p>https://www.open-bio.org/2018/08/02/taking-turns/Thu, 02 Aug 2018 16:55:44 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/08/02/taking-turns/<p><strong>BOSC 2019 will be part of ISMB 2019</strong> Every year until 2018, BOSC was part of the annual ISMB conference as a community of special interest (COSI, formerly known as a SIG, Special Interest Group). As part of our continuing quest to broaden and deepen the BOSC community, we decided to perform an experiment this year by partnering with the Galaxy Community Conference rather than with ISMB. <a href="https://news.open-bio.org/2018/07/27/gccbosc-2018-post-meeting-report/">As we reported</a>, the experiment was a success&ndash;participants were overwhelmingly positive about the experience, and the conference did attract a somewhat different mix of attendees than in past years. However, we also concluded that there are some advantages to meeting with ISMB&ndash;for example, it attracts more students and postdocs, and the presence of other COSI tracks provides a wider range of scientific topics. Moreover, unlike the GCC 2018 venue, the venue already chosen for <a href="https://galaxyproject.org/galaxy-updates/2018-08/">GCC 2019</a> has a number of drawbacks: we wouldn’t be able to run similarly-sized parallel sessions; registration prices wouldn’t be as affordable as in 2018; and the venue would not be able to accommodate the larger (160 people) and longer (four days) CollaborationFest that was one of the highlights of GCCBOSC 2018.For these and other reasons, the BOSC organizing committee concluded that <strong>the best way to serve the broadest community of potential BOSC attendees will be to partner with ISMB some years and GCC some years.</strong> We therefore plan to hold BOSC 2019 in Basel as part of ISMB. We hope to partner with GCC in 2020 at a North American site to be determined, or in 2021 in Europe.Wherever we hold future BOSCs, you can be sure that they will include a wide range of topics in open science and open source bioinformatics, and we hope that they will draw an ever-diversifying mix of attendees. As always, we welcome your feedback about what you liked in past BOSCs and your suggestions for the future. Feel free to email us ( <a href="mailto:bosc@open-bio.org">bosc@open-bio.org</a>) or tweet (@OBF_BOSC).</p>https://www.open-bio.org/2018/06/27/biopython-1-72-released/Wed, 27 Jun 2018 19:06:41 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/06/27/biopython-1-72-released/<p>Dear Biopythoneers,</p> <p>I&rsquo;m writing this in Portland at the <a href="https://gccbosc2018.sched.com/">GCC BOSC 2018 conference</a>, where I will present the Biopython Project Update 2018 talk tomorrow. Yesterday during my airport layover in Iceland, I published the Biopython 1.72 release to our website and PyPI:</p> <p><a href="https://biopython.org/wiki/Download">https://biopython.org/wiki/Download</a> <a href="https://pypi.python.org/pypi/biopython/1.72">https://pypi.python.org/pypi/biopython/1.72</a></p> <p>This release of Biopython supports Python 2.7, 3.4, 3.5 and 3.6. It has also been tested on PyPy2.7 v6.0.0 and PyPy3.5 v6.0.0.</p> <p>Internal changes to Bio.SeqIO have sped up the SeqRecord .format method and SeqIO.write (especially when used in a for loop).</p> <p>The MAF alignment indexing in Bio.AlignIO.MafIO has been updated to use inclusive end co-ordinates to better handle searches at end points. This will require you to rebuild any existing MAF index files.</p> <p>In this release more of our code is now explicitly available under either our original &ldquo;Biopython License Agreement&rdquo;, or the very similar but more commonly used &ldquo;3-Clause BSD License&rdquo;. See the LICENSE.rst file for more details.</p> <p>The Entrez module now supports the NCBI API key. Also you can now set a custom directory for DTD and XSD files. This allows Entrez to be used in environments like AWS Lambda, which restricts write access to specific directories. Improved support for parsing NCBI Entrez XML files that use XSD schemas.</p> <p>Internal changes to our C code mean that NumPy is no longer required at compile time - only at run time (and only for those modules which use NumPy).</p> <p>Seq, UnknownSeq, MutableSeq and derived classes now support integer multiplication methods, matching native Python string methods.</p> <p>A translate method has been added to Bio.SeqFeature that will extract a feature and translate it using the codon_start and transl_table qualifiers of the feature if they are present.</p> <p>Bio.SearchIO is no longer considered experimental, and so it does not raise warnings anymore when imported.</p> <p>A new pairwise sequence aligner is available in Bio.Align, as an alternative to the existing pairwise sequence aligner in Bio.pairwise2.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Benjamin Vaisvil (first contribution)</li> <li>Blaise Li</li> <li>Chad Parmet</li> <li>Chris Rands</li> <li>Connor T. Skennerton</li> <li>Francesco Gastaldello</li> <li>Michiel de Hoon</li> <li>Pamela Russell (first contribution)</li> <li>Peter Cock</li> <li>Spencer Bliven</li> <li>Wibowo &lsquo;Bow&rsquo; Arindrarto</li> </ul> <p>Thank you all.</p> <p>Peter</p> <p>P.S. You can follow <a href="https://twitter.com/Biopython">@Biopython on Twitter</a></p> <p>&ndash;</p> <p>Checksums for interest/public record:</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>$ shasum -a 256 biopython-1.72* </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>abc14a111ed89332c902d239f516cc9ab84ab4458b577c61208dc4c20b74dc83 </span></span><span style="display:flex;"><span>biopython-1.72-cp27-cp27m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>3e8c85d4a3295be598a9e9616adeed8a4f81bd0452326aaea7bf81cca468f7c1 </span></span><span style="display:flex;"><span>biopython-1.72-cp27-cp27m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>f1b4abd90d0c84ab2c5dab704da1d397cf75ee41f72619a1802479c3768ac347 </span></span><span style="display:flex;"><span>biopython-1.72-cp27-cp27m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>b426a2d858414bed0c25fca155fdf27485347ce6f69805db65b8b36ec00a0f41 </span></span><span style="display:flex;"><span>biopython-1.72-cp27-cp27mu-manylinux1_i686.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>71762c193ffc9a1b936dfaa2d456fb172856f0952090483ee4a84635a1aa6fe3 </span></span><span style="display:flex;"><span>biopython-1.72-cp27-cp27mu-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>57a449709df7a47980360ecbd2f195effc56e9b0253fa0e74fb00b10b44778e0 </span></span><span style="display:flex;"><span>biopython-1.72-cp27-cp27m-win32.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>3d3deb59c3f5d04d41aec443db4e89dbbdd0bb7749078f91e797935849c8db48 </span></span><span style="display:flex;"><span>biopython-1.72-cp27-cp27m-win_amd64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>b76241a55a1ba832c2768733fb113eef1fdfa1d738aa1f84fcdd4ba0b6432394 </span></span><span style="display:flex;"><span>biopython-1.72-cp34-cp34m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>ad2c72c289561d51f6f7a9ae977e9cd54cd48b575b946421f82ede1ac24198cb </span></span><span style="display:flex;"><span>biopython-1.72-cp34-cp34m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>3a199d469465c4f3c4c238f688d07b9bce4f504be73dead6cdf5d36a47728fcd </span></span><span style="display:flex;"><span>biopython-1.72-cp34-cp34m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>16a99e2462ee5acb6962f3a1d344336db58d7b87acf9d5023beb3efe6ebb47a8 </span></span><span style="display:flex;"><span>biopython-1.72-cp34-cp34m-win32.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>defd163110d698ea534e470995c68c519bd56e4e23043ae9dd8b646f2a803e5b </span></span><span style="display:flex;"><span>biopython-1.72-cp34-cp34m-win_amd64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>5882ba8fb87cbbe36d9e5d87c9b8f3139d503fe7da1023b472760a8122e579e6 </span></span><span style="display:flex;"><span>biopython-1.72-cp35-cp35m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>99faabef8c563bf5a9ed80ea677a5fd9edab5c06405a08fe44fb0f5bd4f6af38 </span></span><span style="display:flex;"><span>biopython-1.72-cp35-cp35m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>539a475c263b68cd1ae3624648090bf1a5d853ec967d450e4cb991e63f72cb05 </span></span><span style="display:flex;"><span>biopython-1.72-cp35-cp35m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>874a3c30bf7287e003e3668b55bd73a243edb85f4249826cff54b6fe3740483a </span></span><span style="display:flex;"><span>biopython-1.72-cp35-cp35m-win32.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>db3517d654c2ca81c57b2e4e5340650b55055eb3985e5732c5ec668cf70143f1 </span></span><span style="display:flex;"><span>biopython-1.72-cp35-cp35m-win_amd64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>2fbfe0f2d7b731b638c41466987cf00e36e08502b3db2b2d72beb9cbb79097e3 </span></span><span style="display:flex;"><span>biopython-1.72-cp36-cp36m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>6d8e56e46cccc38fb8ac026e70f700528f0d5e6f264d03f9c348fb81dd7e65b6 </span></span><span style="display:flex;"><span>biopython-1.72-cp36-cp36m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>6d27eb0fda18f2f70661bcd498f2aa0148ce56953aac094c35d8a12fb8261482 </span></span><span style="display:flex;"><span>biopython-1.72-cp36-cp36m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>d3c7ba7b0ffb3dd5132093d4fb21782daccc0e41358e5887676c455e1ae841c9 </span></span><span style="display:flex;"><span>biopython-1.72-cp36-cp36m-win32.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>5e0b830ff270b16abf1f050a8bf4732c9f2da29d27fdd2be9aeab76b6d087919 </span></span><span style="display:flex;"><span>biopython-1.72-cp36-cp36m-win_amd64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>ab6b492443adb90c66267b3d24d602ae69a93c68f4b9f135ba01cb06d36ce5a2 </span></span><span style="display:flex;"><span>biopython-1.72.tar.gz </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>08e1d6b43d974efc3578a5e8eebe6c118b03feea21b96d964c7e461c5cf53c18 </span></span><span style="display:flex;"><span>biopython-1.72.zip </span></span></code></pre></div><div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>$ md5sum biopython-1.72* </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>661d50514eaa8151192b2127f52a8f5e </span></span><span style="display:flex;"><span>biopython-1.72-cp27-cp27m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>a66e12a83c44ee50f01888129658eba0  biopython-1.72-cp27-cp27m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>d7eb8003d855b3b425e2d7b5062d390a </span></span><span style="display:flex;"><span>biopython-1.72-cp27-cp27m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>13b4e63a2a4c97e3fefa5360425f5199  biopython-1.72-cp27-cp27mu-manylinux1_i686.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>a5a418d1c4b6a2e58ccb73bafdc60a3e </span></span><span style="display:flex;"><span>biopython-1.72-cp27-cp27mu-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>e6ca44a18b5fc65e7ca4267f877fd9cc  biopython-1.72-cp27-cp27m-win32.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>4978d56508b002591e7b6c931c5d54f4  biopython-1.72-cp27-cp27m-win_amd64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>eed950f7b23a3c42682f3f635a135e57 </span></span><span style="display:flex;"><span>biopython-1.72-cp34-cp34m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>50e8fc0e63ca3ad524ea8c5d237ed6b1  biopython-1.72-cp34-cp34m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>d20e9cfa98ee8991b7008f64a44f6130 </span></span><span style="display:flex;"><span>biopython-1.72-cp34-cp34m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>1ea11554a42996491c847ae0cf36de97  biopython-1.72-cp34-cp34m-win32.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>848d5d53c3a6c60d9e94528e6cc35087  biopython-1.72-cp34-cp34m-win_amd64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>bde20eb5d6abdaa6479113dc96690603 </span></span><span style="display:flex;"><span>biopython-1.72-cp35-cp35m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>75b83b673997dbae8a8fe1a6fa15d3e3  biopython-1.72-cp35-cp35m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>b883f5439353885224789b9e25107661 </span></span><span style="display:flex;"><span>biopython-1.72-cp35-cp35m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>d76442d3fc18de8953936a6c5ef5a79f  biopython-1.72-cp35-cp35m-win32.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>f043fa59e3fbd5d505599474aaed74b5  biopython-1.72-cp35-cp35m-win_amd64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>dab6b61605938b75eef18fa9cae944da </span></span><span style="display:flex;"><span>biopython-1.72-cp36-cp36m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>49fd975593798f0d7a293ebe327f800e  biopython-1.72-cp36-cp36m-manylinux1_i686.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>8259fbf571b15dc05f0405b5e99394ce </span></span><span style="display:flex;"><span>biopython-1.72-cp36-cp36m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>4e0d4de83b89d632a5dad9ee417306f2  biopython-1.72-cp36-cp36m-win32.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>acdf4e57da4fc90bf7c52c76c2bf4182  biopython-1.72-cp36-cp36m-win_amd64.whl </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>418fecc41f75353fde30de73586900ac  biopython-1.72.tar.gz </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>e1db4737caf6bd2f7443f7e3c986ebbb  biopython-1.72.zip </span></span></code></pre></div>https://www.open-bio.org/2018/06/14/obf-bof-gccbosc-2018/Thu, 14 Jun 2018 18:11:25 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/06/14/obf-bof-gccbosc-2018/<p>If you&rsquo;re going to <a href="https://gccbosc2018.sched.com/">GCCBOSC 2018</a>, we invite you to join us at the <a href="https://gccbosc2018.sched.com/event/FCGp">OBF Birds of a Feather</a> on Wednesday, June 27, from 5:40-7:40pm. Come and chat over dinner! Everyone is invited, whether you&rsquo;re a longtime OBF member or someone who&rsquo;s never even heard of the OBF. (By the way, anyone who is involved in open source or open science is welcome to <a href="https://www.open-bio.org/wiki/Membership">join the OBF</a>, and there is no membership fee.) More details at <a href="https://gccbosc2018.sched.com/event/FCGp">https://gccbosc2018.sched.com/event/FCGp</a> We look forward to seeing some of you there!</p>https://www.open-bio.org/2018/05/22/saving-science-from-itself-2018-elife-innovation-sprint/Tue, 22 May 2018 12:54:41 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/05/22/saving-science-from-itself-2018-elife-innovation-sprint/<p><em>This is a guest blog post from <a href="https://github.com/akeshavan">Anisha Keshavan</a>, who was supported by the ongoing <a href="https://github.com/OBF/obf-docs/blob/master/Travel_fellowships.md">Open Bioinformatics Foundation travel fellowship</a> program to attend the <a href="https://elifesciences.org/events/c40798c3/elife-innovation-sprint-2018">2018 eLife Innovation Sprint</a> in Cambridge, May 2018. The OBF&rsquo;s Travel Fellowship program continues to help open source bioinformatics software developers with funding to attend conferences or workshops. This was one of <a href="https://news.open-bio.org/2018/05/25/travel-fellowships-april-2018/">three awards from our April 2018 travel fellowships call</a>. The current call closes 15 August 2018, you might want to apply?</em> It is hard for me to put into words the thrill, excitement, and inspiration I’m feeling after attending the 2 day eLife Innovation sprint on May 10th and 11th. The <em><strong>#eLifeSprint</strong></em> ( <a href="https://elifesciences.org/events/c40798c3/elife-innovation-sprint-2018">https://elifesciences.org/events/c40798c3/elife-innovation-sprint-2018</a>) in Cambridge, UK, brought together software developers, researchers, designers, and anyone who was passionate about leveraging web technology to advance open scientific communication. The goal: to save science from itself!</p> <p>What do I even mean by this? Well, let me explain how the process unfolds:</p> <ol> <li>Get some background knowledge on your topic of interest, read a bunch of publications and about all the experiments and theories up to this point in time <strong><em>#readallthepubs</em></strong></li> <li>Think of a new scientific hypothesis or theory, design an experiment to test it</li> <li>Write up <em>exactly</em> what you did in your experiment, the results, and your interpretation <strong><em>#reproduceit</em></strong></li> <li>Show your write up to your peers and have them review it &ndash; it’s their job to make sure what you did was legit, and that your results and  interpretation makes sense <strong><em>#sanitycheck</em></strong></li> <li>Share it with the scientific community and world, which adds to the growing pile of theories/evidence/background in 1. <em><strong>#sharetheknowledge</strong></em></li> </ol> <p>Sounds great. Why do we need to save science from itself?</p> <p><em><strong>#readallthepubs</strong></em>: Turns out, scientists are publishing SO MUCH that its nearly impossible to read and comprehend all the scientific literature out on the web. This is also called research debt (and here&rsquo;s a great article: <a href="https://distill.pub/2017/research-debt/">https://distill.pub/2017/research-debt/</a> )</p> <p><em><strong>#reproduceit</strong></em>: You&rsquo;d think computers would have made our lives easier because we can  automate data analyses, but actually reproducing an analysis is really difficult. Describing what the analysis code does in the methods section of a paper just doesn&rsquo;t cut it. And if another scientist can&rsquo;t reproduce an experiment, can we trust the original experiment&rsquo;s outcome?</p> <p><strong><em>#sanitycheck</em></strong>: Reviewing a paper well is a lot of work! Peer reviewers do this for free and anonymously, which sucks because they never get recognized for the work they put in. Understandably, its not a high priority to review papers in a timely manner, and this means that important research findings don&rsquo;t get published for a long time.<em><strong>#sharetheknowledge</strong></em>: Now that a scientist has read all the background on their topic of interest, designed and ran a reproducible experiment, and revised their manuscript based on peer review, they submit their article to a journal so that other scientists all over the world can read it. Usually, they <em>pay</em> the journal to publish their paper, and then other scientists also <em>pay</em> the journal to read the paper (Yes, these journals make BANK $$$). If you and your institution can&rsquo;t pay all the fees, that&rsquo;s a bummer. In fact, its a bummer for all of science! Progress is majorly hindered when bright, intelligent scientists with something to contribute to a field don&rsquo;t have access to vital information because they can&rsquo;t pay publishers. For example, <a href="https://www.nytimes.com/2015/04/08/opinion/yes-we-were-warned-about-ebola.html?_r=0">a Liberian physician doesn&rsquo;t have access to Ebola research articles because each article costs half a weeks salary</a>. Information needs to be open to everyone, regardless of how much money you have.</p> <p>Ok, so clearly science needs a major course correction. Enter: the 2018 eLife innovation sprint! In the following sections I&rsquo;ll list the project prototypes and links from the sprint that aim to correct one or more of the the four topics above.</p> <h2 id="readallthepubs">#readallthepubs</h2> <p><a href="https://appstract.pub">https://appstract.pub</a> :My team! We built a citizen science game to collect annotations on publications, so that we can run meta-analyses to summarize a large set of publications. You can compete with friends on the leaderboard, win badges, and contribute to science!<img src="https://pbs.twimg.com/media/Dc7Gw6PWsAA7AQk.jpg" alt="team appstract!"><a href="https://github.com/Samwalton9/WikiCiteVis">WikiCiteViz</a>:  A project to visualize citations, so you can see how a study has influenced other studies in the field.<a href="https://github.com/Bubblbu/zotero-insights">Zotero Insights</a>:  When you read papers, you can take notes in Zotero on a PDF. This project extracts all your notes (or annotations) and puts it into a machine-readable format, and creates reports and analyses of your notes<img src="http://citationgecko.com/" alt="Citation Gecko">: a way to find more relevant papers to read using citation data, and finds papers you may have missed.<a href="https://github.com/nlisgo/abstract-babel">Abstract Babel</a>: what it sounds like! Translate abstracts to different languages . I don&rsquo;t speak any other languages, but they say the translations are solid!</p> <p><a href="https://docs.google.com/presentation/d/1dM_HWimJ0SIfl9D3clhqKpxq04sLCVKOoNcxiHw0Myw/edit#slide=id.p">Funda</a>: a project <a href="https://docs.google.com/document/d/1R8AdItJ6cVivrCm6zWuMykz_rrCoj_o7vSMzNUQ6F7E/edit">roadmap</a> for teaching web literacy in South Africa.</p> <h2 id="reproduceit">#reproduceit</h2> <p>New technology has made our science experiments a little more complicated. We’re collecting a ton of data, and we write a lot of custom programs to crunch the numbers and make inferences. It turns out that sometimes what works on your computer won’t work on someone else’s! It can take a lot of CS skills to get the same analysis running on your computer, and that really slows us down. The following tools can help address this:<a href="https://github.com/popperized/open-comp-rsc-popper">Reproducible computational research</a>:a case study that shows reproducible computational neuroscience research using <a href="http://falsifiable.us/">Popper</a> and <a href="https://pythonhosted.org/Sumatra/">Sumatra</a> .<a href="https://github.com/dat-land/project-trackbook">Project Trackbook</a>:an open lab notebook that &ldquo;gives researchers an interface to securely share and version control files in a <em>decentralized</em> network&rdquo;.<a href="https://github.com/minrk/jupyter-dar/">Jupyter + Stencila</a>: combines some great tools: the <a href="http://stenci.la/">Stencila editor</a>, the <a href="http://jupyter.org/">Jupyter notebook</a>, and <a href="https://mybinder.org/">mybinder</a>, to create &ldquo;interactive, reproducible, and transparent&rdquo; scientific articles!</p> <h2 id="sanitycheck">#sanitycheck</h2> <p><a href="https://octopus-hypothesis.netlify.com/">Project Octopus</a>: This was probably the biggest group at the sprint, and covers both the <em>#sanitycheck</em> and <em>#sharetheknowledge</em>. On the octopus platform, you&rsquo;ll be able to review other scientist&rsquo;s work, and get credit for doing so! You should also checkout the blog on their website, which does <a href="https://octopus-hypothesis.netlify.com/blog/2018/05/13/2018-05-13_fixingscience/">a great job explaining in depth the problems we face in science, and how octopus can help</a>.<a href="https://github.com/SamanthaHindle/preprint_JournalClub">PREreview</a>: &quot; <em>Putting the ‘peer’ back into peer review!&quot;</em> Many scientists have started to upload their manuscripts to preprint servers, so that scientists can access the information before the lengthy peer-review and publication process. And this is really great for authors! For example, <a href="https://arxiv.org/pdf/1805.05238.pdf">here</a> is a preprint on how preprints that are posted before conference submission garner more citations than those posted after. PREreview is a platform for the &ldquo;collaborative writing of preprint reviews&rdquo; :) I found a very useful blog post on their site on <a href="https://prereview.org/users/164141/articles/200820-prereview-guidelines-how-to-write-a-preprint-review">guidelines for writing a preprint review</a>.</p> <h2 id="sharetheknowledge">#sharetheknowledge</h2> <p><a href="https://octopus-hypothesis.netlify.com/">Project Octopus</a>: On the octopus platform, all published work will be open to everython, and as a scientist, you&rsquo;ll be able to &ldquo;publish your hypotheses, methods, results and analyses in Octopus as you produce them, in whatever language you are most comfortable in&rdquo;.<a href="http://sarabosshart.wixsite.com/plauditpub">Plaudit</a>: It would be great if the value of the paper was not dependent on journal status, but instead on the quality of the work! Plaudit lets you publicly endorse an article, so that scientists don&rsquo;t have to worry about whether your article is published in a name brand journal, and it incentivizes open publishing and publishing preprints.</p> <h2 id="conclusions">Conclusions</h2> <p>Sometimes I feel really pessimistic about science, because of how inefficient and unfair it can be. But all the amazing participants at the eLifeSprint showed me that 1) SO many people care about these issues, 2) people have brilliant ideas and prototypes to address these issues, and 3) how many tools already exist, that I just didn&rsquo;t know about until I attended the sprint (I was excited to learn about the amazing <a href="https://openaccessbutton.org">openaccessbutton.org</a> API). Overall I left feeling very optimistic about the future of science! Thanks to Naomi Penfold and eLife for organizing this amazing event, and especially, <a href="https://news.open-bio.org/2018/05/25/travel-fellowships-april-2018/">thanks to OBF for the travel award</a> so that I could attend!</p>https://www.open-bio.org/2018/04/09/biojava-5-0-0-is-out/Mon, 09 Apr 2018 17:37:14 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/04/09/biojava-5-0-0-is-out/<p>BioJava 5.0.0 was released on the 23rd of March 2018. This represents a major milestone that brings more consolidation and reorganisation of modules. This is the first release to be based on Java 8, bring in your lambdas and stream API calls!</p> <p>The release represents work done in the last 2 years, alpha releases were available for quite some time and now this makes all the changes officially public.</p> <p>Some major refactoring occurred in the biojava-structure module. The data model to deal with macromolecular structures has been adapted to be closer to the mmCIF data model. Other improvements in biojava-structure are support for MMTF format and improved symmetry detection code.</p> <p>See the <a href="https://github.com/biojava/biojava/releases/tag/biojava-5.0.0">full release notes</a> or browse the official <a href="http://biojava.org/docs/api/">API documentation</a>.</p>https://www.open-bio.org/2018/04/04/biopython-1-71-released/Wed, 04 Apr 2018 15:32:14 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/04/04/biopython-1-71-released/<p>Dear Biopythoneers,</p> <p>Source distributions of Biopython 1.71 are now available from the <a href="http://biopython.org/wiki/Download">downloads page</a> on the official <a href="http://biopython.org/">Biopython website</a>, and the release is also <a href="https://pypi.python.org/pypi/biopython/1.71">on the Python Package Index (PyPI)</a> including pre-compiled Wheel Packages for Linux, Mac OS X and Windows.</p> <p>This release of Biopython supports Python 2.7, 3.4, 3.5 and 3.6 (we have now dropped support for Python 3.3). It has also been tested on PyPy2.7 v5.10.0 and PyPy3.5 v5.10.1.</p> <p>Python 3 is the primary development platform for Biopython. We will drop support for Python 2.7 no later than 2020, in line with the end-of-life or sunset date for Python 2.7 itself.</p> <p><em><strong>Setup changes:</strong></em></p> <p>We now explicitly recommend installation using &ldquo;pip install biopython&rdquo;, rather than the classic &ldquo;python setup.py install&rdquo; approach. In a related change, we depend on the Python package setuptools (rather than the older package distutils in the Python standard library) and have made the dependency on NumPy explicit and automatic.</p> <p><em><strong>License changes:</strong></em></p> <p>As of Biopython 1.69, we have started to dual-license Biopython under both our original liberal “Biopython License Agreement”, and the very similar but more commonly used “3-Clause BSD License”. A growing number of the Python files are explicitly available under either license, but most of the code remains under the “Biopython License Agreement” only. See the <a href="https://github.com/biopython/biopython/blob/master/LICENSE.rst">LICENSE</a> file for more details.</p> <p><em><strong>Code changes:</strong></em></p> <p>Encoding issues have been fixed in several parsers when reading data files with non-ASCII characters, like accented letters in people&rsquo;s names. This would raise <code>UnicodeDecodeError: 'ascii' codec can't decode byte ...</code> under some system locale settings.</p> <p>Bio.KEGG can now parse Gene files.</p> <p>The multiple-sequence-alignment object used by Bio.AlignIO etc now supports a per-column annotation dictionary, useful for richly annotated alignments in the Stockholm/PFAM format.</p> <p>The SeqRecord object now has a translate method, following the approach used for its existing reverse_complement method etc.</p> <p>The output of function <code>format_alignment</code> in <code>Bio.pairwise2</code> for displaying a pairwise sequence alignment as text now indicates gaps and mis-matches.</p> <p>Bio.SeqIO now supports reading and writing two-line-per-record FASTA files under the format name &ldquo;fasta-2line&rdquo;, useful if you wish to work without line-wrapped sequences.</p> <p>Bio.PDB now contains a writer for the mmCIF file format, which has been the standard PDB archive format since 2014. This allows structural objects to be written out and facilitates conversion between the PDB and mmCIF file formats.</p> <p>Bio.Emboss.Applications has been updated to fix a wrong parameter in fuzznuc wrapper and include a new wrapper for fuzzpro.</p> <p>The restriction enzyme list in Bio.Restriction has been updated to the November 2017 release of REBASE.</p> <p>New codon tables 27-31 from NCBI (NCBI genetic code table version 4.2) were added to Bio.Data.CodonTable. Note that tables 27, 28 and 31 contain no dedicated stop codons; the stop codons in these codes have a context dependent encoding as either STOP or as amino acid.</p> <p>IO functions such as <code>SeqIO.parse</code> now accept any objects which can be passed to the builtin <code>open</code> function. Specifically, this allows using <code>pathlib.Path</code> objects under Python 3.6 and newer, as per <a href="https://www.python.org/dev/peps/pep-0519">PEP 519</a>.</p> <p>Bio.SearchIO can now parse InterProScan XML files.</p> <p>For Python 3 compatibility, comparison operators for the entities within a Bio.PDB Structure object were implemented. These allow the comparison of models, chains, residues, and atoms with the common operators (==, !=, &gt;, &hellip;) Comparisons are based on IDs and take the parents of the entity up to the model level into account. For consistent behaviour of all entities the operators for atoms were modified to also consider the parent IDs. NOTE: this represents a change in behaviour in respect to v1.70 for Atom comparisons. In order to mimic the behaviour of previous versions, comparison will have to be done for Atom IDs and alternative locations specifically.</p> <p>Additionally, a number of small bugs have been fixed with further additions to the test suite, and there has been further work to follow the Python <a href="https://www.python.org/dev/peps/pep-0008">PEP8</a>, <a href="https://www.python.org/dev/peps/pep-0257">PEP257</a> and best practice standard coding style.</p> <p><em><strong>Acknowledgements:</strong></em></p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Adhemar Zerlotini</li> <li>Ariel Aptekmann</li> <li>Chris Rands</li> <li>Christian Brueffer</li> <li>Erik Cederstrand (first contribution)</li> <li>Fei Qi (first contribution)</li> <li>Francesco Gastaldello</li> <li>James Jeffryes (first contribution)</li> <li>Jerven Bolleman (first contribution)</li> <li>Joe Greener (first contribution)</li> <li>Joerg Schaarschmidt (first contribution)</li> <li>João Rodrigues</li> <li>Jeroen Van Goey</li> <li>Jun Aruga (first contribution)</li> <li>Kai Blin</li> <li>Kozo Nishida</li> <li>Lewis A. Marshall (first contribution)</li> <li>Markus Piotrowski</li> <li>Michiel de Hoon</li> <li>Nicolas Fontrodona (first contribution)</li> <li>Peter Cock</li> <li>Philip Bergstrom (first contribution)</li> <li>rht (first contribution)</li> <li>Saket Choudhary</li> <li>Shuichiro MAKIGAKI (first contribution)</li> <li>Shyam Saladi (first contribution)</li> <li>Siong Kong</li> <li>Spencer Bliven</li> <li>Stefans Mezulis</li> <li>Steve Bond</li> <li>Yasar L. Ahmed (first contribution)</li> <li>Zachary Sailer (first contribution)</li> <li>Zaid Ur-Rehman (first contribution)</li> </ul> <p>Thank you all.</p> <p>P.S. You can follow <a href="https://twitter.com/Biopython">@Biopython on Twitter</a> <em><strong>Checksums</strong></em>:</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>$ md5sum biopython-1.71* </span></span><span style="display:flex;"><span>b2cd1215bacfb7cb9ee73b6b67695da0 biopython-1.71-cp27-cp27m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span>a85b46133003383e428b05895e5d3613 biopython-1.71-cp27-cp27m-manylinux1_i686.whl </span></span><span style="display:flex;"><span>89e368cbcb6517915ee371f27f459b90 biopython-1.71-cp27-cp27m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span>395e12573e9a56130489aafe3617e254 biopython-1.71-cp27-cp27mu-manylinux1_i686.whl </span></span><span style="display:flex;"><span>f80e811aeebf9241e03a6ef3d4c9d9c6 biopython-1.71-cp27-cp27mu-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span>b98d04351a94eb94a95e57c4ded460c2 biopython-1.71-cp27-cp27m-win32.whl </span></span><span style="display:flex;"><span>4997d76f075f4840d82f7d596917ba92 biopython-1.71-cp27-cp27m-win_amd64.whl </span></span><span style="display:flex;"><span>47b6e58c03599b4e8a5534efa9171d0c biopython-1.71-cp34-cp34m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span>53df08929d39abda3c0b668d7d06456c biopython-1.71-cp34-cp34m-manylinux1_i686.whl </span></span><span style="display:flex;"><span>d308f83c49dc38395928348628d24238 biopython-1.71-cp34-cp34m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span>a2f05c067222c31091ad97c6c394e54d biopython-1.71-cp34-cp34m-win32.whl </span></span><span style="display:flex;"><span>b5f26e1288f5124a2a02ffeab7139650 biopython-1.71-cp35-cp35m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span>0f5e731a17b3d5798347a21b88224583 biopython-1.71-cp35-cp35m-manylinux1_i686.whl </span></span><span style="display:flex;"><span>4f1fa297348d4797acab537b44480aaa biopython-1.71-cp35-cp35m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span>cf859db69d1c182f133cd34774ff15ca biopython-1.71-cp35-cp35m-win32.whl </span></span><span style="display:flex;"><span>9eb34690189f4c156157e0991852bb56 biopython-1.71-cp35-cp35m-win_amd64.whl </span></span><span style="display:flex;"><span>80cf17e84f22a4ea61e7394a521500f9 biopython-1.71-cp36-cp36m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span>09fbad06133a8b2b9c3d20faa0d6a156 biopython-1.71-cp36-cp36m-manylinux1_i686.whl </span></span><span style="display:flex;"><span>d7e15723aac481d945289d179a52a9f9 biopython-1.71-cp36-cp36m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span>80c03614cb3b4c486793e6e31c62403d biopython-1.71-cp36-cp36m-win32.whl </span></span><span style="display:flex;"><span>dc7149f7297176bf0c8ca80fa176ecb0 biopython-1.71-cp36-cp36m-win_amd64.whl </span></span><span style="display:flex;"><span>966ac542f39809c37852410a95f641fb biopython-1.71.tar.gz </span></span><span style="display:flex;"><span>4c63ec2a2908adf8d3338f8e8b180514 biopython-1.71.zip </span></span></code></pre></div><div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>$ shasum -a 256 biopython-1.71* </span></span><span style="display:flex;"><span>f919aa78031c00e44350742331f5a1eed7b447bde7812abe2ca0f6a5165900bb biopython-1.71-cp27-cp27m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span>7449d7df74a298c190fbc9ad60591577acb2e45d5ff788faa8672df460f3dc4d biopython-1.71-cp27-cp27m-manylinux1_i686.whl </span></span><span style="display:flex;"><span>3fdf4c9502404dd62905fd70bce57806cb775e636eede5de13f1abe8f0915158 biopython-1.71-cp27-cp27m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span>4960e0ec35de8b02cd0b6a720db623abf30931a5677046ec06c0097b6a565541 biopython-1.71-cp27-cp27mu-manylinux1_i686.whl </span></span><span style="display:flex;"><span>4e4c6fe00e1d49e016634602e8554380ec437b505d8f20132da408a37da560ce biopython-1.71-cp27-cp27mu-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span>65f00db00b2f91ba90e5bb61c7dd14d2beacb9f2d3e60c9d4330376b693d8975 biopython-1.71-cp27-cp27m-win32.whl </span></span><span style="display:flex;"><span>6318172b107ad72abf45a03de6a189a3e7cfc2e682d402520c14bbbe8295e335 biopython-1.71-cp27-cp27m-win_amd64.whl </span></span><span style="display:flex;"><span>5b7284947a4b657d7955d0af8c48594be62a4d8dd51b84223fded371e81911d6 biopython-1.71-cp34-cp34m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span>20fbbbc0f1c2f11972ea598191ba2cd8cb7ecb38595fa89031b9c3974ebcbdff biopython-1.71-cp34-cp34m-manylinux1_i686.whl </span></span><span style="display:flex;"><span>9fabcb8cd0a87c5e2514bc959f5504ea5dc58219bc2ff91e6c689279322319c6 biopython-1.71-cp34-cp34m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span>038ecb2376cbfd2b42e79f64fe96ffb4921fecacad6f5157b684168933320455 biopython-1.71-cp34-cp34m-win32.whl </span></span><span style="display:flex;"><span>b7782271639fb92ea7fde4ad1caeeed3ca4ba6795de81bde391a4ea21e3870fb biopython-1.71-cp35-cp35m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span>14067b4ae2596979fd82a1e61fafbf2f8acd81f547b09220d8f4d7642a2b3759 biopython-1.71-cp35-cp35m-manylinux1_i686.whl </span></span><span style="display:flex;"><span>1c6190b552c5b9e2b2b7456ecc5258f344b1afee63c1d656b610a5c1a4b52b3f biopython-1.71-cp35-cp35m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span>23580bf169d044cc749819465520f33579c62ce06816f87f814e4a78fdd48877 biopython-1.71-cp35-cp35m-win32.whl </span></span><span style="display:flex;"><span>f2603eeb09a7eef41eb81d874901c02e848ad80776f9e80d91b15206e7c4441d biopython-1.71-cp35-cp35m-win_amd64.whl </span></span><span style="display:flex;"><span>9f800d7db93685a73fe244d16ab76dec91e51ddcde20a3f9e8dffa3d05170d96 biopython-1.71-cp36-cp36m-macosx_10_6_intel.macosx_10_9_intel.macosx_10_9_x86_64.macosx_10_10_intel.macosx_10_10_x86_64.whl </span></span><span style="display:flex;"><span>4b7f6552b4d9162ca90bc0515a93815a7d81b8b0435932ab0aaf2affc53b40f6 biopython-1.71-cp36-cp36m-manylinux1_i686.whl </span></span><span style="display:flex;"><span>6ac8e5c2f6ffa1190a491ccc5f00e004d05107abf9879ebdff202088be31d02a biopython-1.71-cp36-cp36m-manylinux1_x86_64.whl </span></span><span style="display:flex;"><span>693e9f2955393438613a431fe9b308d3d39a30923fe1efd32e0000c83feda6e3 biopython-1.71-cp36-cp36m-win32.whl </span></span><span style="display:flex;"><span>dccb66a68968c4c76a7ec92d82e44abf8721a2f65c9afb7acdc3deb2457b7b4e biopython-1.71-cp36-cp36m-win_amd64.whl </span></span><span style="display:flex;"><span>4f1770a29a5b18fcaca759bbc888083cdde2b301f073439ff640570d4a93e033 biopython-1.71.tar.gz </span></span><span style="display:flex;"><span>08e2123c043cbfc4faf483fd59857b7df95662ac706ad9c3c9ef34d7a41b1d2d biopython-1.71.zip </span></span></code></pre></div>https://www.open-bio.org/2018/02/21/gccbosc-2018-a-bioinformatics-community-conference-call-for-abstracts/Wed, 21 Feb 2018 10:07:04 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/02/21/gccbosc-2018-a-bioinformatics-community-conference-call-for-abstracts/<p><a href="https://gccbosc2018.sched.com/"><img src="https://news.open-bio.org/wp-content/uploads/2018/02/gcc-bosc-2018-logo-boxed-150.png" alt="Logo"></a></p> <p>We are pleased to announce that abstract submission and early registration for <a href="https://gccbosc2018.sched.com/">GCCBOSC2018</a> are now open. This event brings our annual <strong>Bioinformatics Open Source Conference</strong> and the <strong>Galaxy Community Conference</strong> together into a unified week-long event. If you work in open source life science or data-intensive biomedical research, then there is no better place than <strong>GCCBOSC 2018</strong> to present your work and to learn from others.</p> <p><strong>Dates</strong>: June 25-30, 2018 <strong>Location</strong>: Reed College, Portland, OR <strong>GCCBOSC website</strong>: <a href="https://gccbosc2018.sched.com/">https://gccbosc2018.sched.com/</a> <strong>BOSC website:</strong> <a href="https://www.open-bio.org/wiki/BOSC_2018">/wiki/BOSC_2018</a> <strong>Email BOSC organizers</strong> <a href="mailto:bosc@open-bio.org">bosc@open-bio.org</a> <strong>BOSC announcements mailing list</strong>: <a href="http://lists.open-bio.org/mailman/listinfo/bosc-announce">http://lists.open-bio.org/mailman/listinfo/bosc-announce</a> <strong>Twitter</strong>: <a href="https://twitter.com/OBF_BOSC">@OBF_BOSC</a>, <a href="https://twitter.com/search?q=%23GCCBOSC">#GCCBOSC</a></p> <h1 id="important-dates">Important Dates</h1> <ul> <li><strong><a href="https://www.open-bio.org/wiki/BOSC_Abstract_Submission">Abstract submission</a> deadline: March 16, 2018</strong></li> <li>Authors notified: April 10, 2018</li> <li><a href="https://github.com/OBF/obf-docs/blob/master/Travel_fellowships.md">Travel fellowship</a> application deadline: April 15, 2017</li> <li>GCCBOSC 2018 Training: June 25-26, 2018</li> <li>GCCBOSC 2018 Talks: June 27-28</li> <li>GCCBOSC CollaborationFest: June 29-30</li> </ul> <h1 id="about-bosc">About BOSC</h1> <p>Since 2000, the yearly Bioinformatics Open Source Conference (BOSC) has provided a forum for developers and users to interact and share research results and ideas in open source bioinformatics. BOSC’s broad spectrum of topics includes practical techniques for solving bioinformatics problems; software development practices; standards and ontologies; approaches that promote open science and sharing of data, results and software; and ways to grow open source communities while promoting diversity within them.</p> <h1 id="why-is-bosc-partnering-with-gcc-in-2018">Why is BOSC partnering with GCC in 2018?</h1> <p>In past years, BOSC has been part of the ISMB conference. Because of our continuing focus on broadening and deepening the BOSC community, we&rsquo;ve been exploring ways to reach those in the bioinformatics community who aren’t already part of the audience attracted by ISMB. As part of that exploration, we have looked at other organizations and conferences that have been successful at establishing a strong and growing community of participants, such as the Galaxy Community Conference (GCC).</p> <p>After much discussion and planning, we decided to hold BOSC in conjunction with GCC in 2018. We hope that this will be an enjoyable and productive experience for all participants, and we welcome your feedback before, during and after the event.</p> <p>As always, BOSC 2018 will include two days of talks and posters, two <a href="https://galaxyproject.org/events/gccbosc2018/keynotes/">keynote speakers</a>, a panel discussion, Birds of a Feather, and more. BOSC sessions will run in parallel with GCC 2018 sessions, with some sessions shared. The two days of talks will be preceded by two days of <a href="https://galaxyproject.org/events/gccbosc2018/training/">training</a> on topics nominated by the community, and will be followed by a two-day CollaborationFest that merges BOSC&rsquo;s Codefest and Galaxy&rsquo;s Developer and User Hackathon Days.</p> <h1 id="abstract-submission">Abstract submission</h1> <p>We encourage you to submit one-page abstracts (due March 16) on any topic relevant to open source bioinformatics or open science. After review, some abstracts will be selected for lightning talks, longer talks, demos and/or posters. Abstract submission instructions and a link to the EasyChair submission portal can be found on <a href="https://www.open-bio.org/wiki/BOSC_Abstract_Submission">/wiki/BOSC_Abstract_Submission</a> <strong>BOSC session topics include</strong> (but are not limited to):</p> <ul> <li>Open Science and Reproducible Research</li> <li>Open Biomedical Data</li> <li>Citizen/Participatory Science</li> <li>Standards and Interoperability</li> <li>Data Science</li> <li>Workflows</li> <li>Visualization</li> <li>Medical and Translational Bioinformatics</li> <li>Developer Tools and Libraries</li> <li>Bioinformatics Open Source Project Progress Reports</li> </ul> <p>We look forward to receiving your abstract and meeting you at GCCBOSC 2018!</p> <p>Sincerely,</p> <p>BOSC 2018 Organizing Committee: Nomi Harris (chair), Heather Wiencko (co-chair), Brad Chapman (co-chair), Peter Cock, Christopher Fields, Bastian Greshake, Karsten Hokamp, Hilmar Lapp, Monica Munoz-Torres</p> <p>P.S. Don&rsquo;t forget to submit your BOSC abstract by March 16 at <a href="https://www.open-bio.org/wiki/BOSC_Abstract_Submission">/wiki/BOSC_Abstract_Submission</a>! Please share this announcement with your colleagues!</p>https://www.open-bio.org/2018/02/11/obf-travel-fellowship-coding-in-the-winter-wonderland-galaxy-admin-training-in-oslo-2018/Mon, 12 Feb 2018 00:59:06 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2018/02/11/obf-travel-fellowship-coding-in-the-winter-wonderland-galaxy-admin-training-in-oslo-2018/<p><em>This blog post is syndicated from a <a href="https://arundecano.wordpress.com/2018/02/01/coding-in-the-winter-wonderland-galaxy-admin-training-in-oslo-2018/">post on Arun Decano&rsquo;s blog</a>, originally published Feb 1, 2018. Arun was supported by the ongoing <a href="https://github.com/OBF/obf-docs/blob/master/Travel_fellowships.md">OBF travel fellowship program</a> to attend a Galaxy Admin Workshop held in Oslo, Norway Jan 7-14, 2018.</em> <em>The OBF&rsquo;s Travel Fellowship program continues to help open source bioinformatics software developers with funding to attend conferences, workshops, or training events. The next call closes 15 April 2018.</em></p> <p>Sharing highlights of my unforgettable experience in the snowy white city of Oslo, Norway from the 7th to the 14th of January, 2018.</p> <p>I submitted a last-minute application for the <a href="https://www.elixir-europe.org/events/european-galaxy-administrator-workshop">Galaxy Admin workshop</a> in the University of Oslo so I was extremely delighted when Dr. Nygard dropped me a message confirming my place for the training. I was thrilled with both the thought of learning how to customize my own Galaxy server and traveling to the <a href="http://www.oslobusinessregion.no/oslo-world-winter-capital/">winter capital of the world</a>!</p> <p>I had a limited understanding about how Galaxy servers work as we have have our own server in the lab. But I knew that Galaxy offers various <a href="https://galaxyproject.github.io/training-material/">efficient pipelines</a> for large genomic data analysis so I was  curious how to get started with it.</p> <p>The facilitators of the training were very prompt in setting our expectations for the event. They constantly sent e-mails with tips on how to get around Oslo and which hotel offers the best yet affordable accommodation. I booked a place in Airbnb for mine so not only did I get trained with Galaxy server administration but I also had a first-hand information about the city from a local. I stayed in 2 different places: somewhere in Blindern during the entire workshop and another one in Rosenborg (close to the city center) for the weekend before my flight back to Dublin. <img src="https://arundecano.files.wordpress.com/2018/02/img-20180112-wa0005.jpg?w=1024&amp;h=768" alt="">View from my Airbnb flat in Blindern The sky was clear and the sun was out on our first day of training. Our instructors, who came from different parts of the world were also the main code contributors to the <a href="https://galaxyproject.github.io/">Galaxy project</a> so everyone was enthusiastic to learn from them.</p> <p>Our training jumpstarted with modules on how to install and deploy Galaxy program via PostgreSQL and nginx databases and basic pre-requisites or dependencies for running the server. We were also taught how to further extend Galaxy installation and customize our “brand” to what we need the server for.</p> <p><a href="https://arundecano.wordpress.com/2018/02/01/coding-in-the-winter-wonderland-galaxy-admin-training-in-oslo-2018/mvdoslopic/"><img src="https://arundecano.files.wordpress.com/2018/02/mvdoslopic.jpg?w=150&amp;h=113" alt=""></a><a href="https://arundecano.wordpress.com/2018/02/01/coding-in-the-winter-wonderland-galaxy-admin-training-in-oslo-2018/img_20180108_190035_851/"><img src="https://arundecano.files.wordpress.com/2018/02/img_20180108_190035_851.jpg?w=150&amp;h=102" alt=""></a></p> <p>The event organizers arranged a get-together dinner for us the next day. We went to <a href="http://www.cafeelias.no/nb/">Cafe Elias Mat &amp; Sant</a> in the city center and had traditional Norwegian dishes: my favorite was the sautéed reindeer! I can’t stop thinking about the poor <em>Rudolph the red-nosed reindeer</em> though the entire time I was eating dinner. <img src="https://s1.wp.com/wp-content/mu-plugins/wpcom-smileys/uneasy.svg" alt=":/"><a href="https://arundecano.wordpress.com/2018/02/01/coding-in-the-winter-wonderland-galaxy-admin-training-in-oslo-2018/#gallery-404-1-slideshow">Click to view slideshow.</a></p> <p>The snow started falling hard come Wednesday yet we continued on with our training about the specifics of Galaxy server administration. <img src="https://arundecano.files.wordpress.com/2018/02/img_20180111_210420_640.jpg?w=240&amp;h=300" alt="">Snow-proof. Even though we had to debug the scripts real-time and as we went along with the workshop, I have to say that our instructors were very keen with time and were very efficient in handling technical challenges. We discussed how to tailor fit the Galaxy configuration file and how to use Ansible to deploy the server.</p> <p>Thursday was scheduled for us participants to deliver lightning talks. Some presented how to link a customized Galaxy server to a larger local (i.e. university) server and others talked about issues they encountered when uploading tools from different providers other than <a href="https://toolshed.g2.bx.psu.edu/">Tool Shed</a>. Everyone had interesting new ideas and expressed their willingness to help address the difficulties raised. It was a very engaging day! <img src="https://arundecano.files.wordpress.com/2018/02/oslo-admin-class.jpg?w=1075" alt="">Taken from Galaxy Project news site: <a href="https://galaxyproject.org/galaxy-updates/2018-02/">https://galaxyproject.org/galaxy-updates/2018-02/</a> Fast-forward to the last day of our workshop: we covered all the topics as scheduled and more! The instructors gave us additional tips and workarounds (that were not listed in the syllabus) on how to create and manage our own Galaxy server. Dr. Björn Grüning of Galaxy-Frieburg and Dr. Marius van den Beek of Curie Institute, Paris also demonstrated several ways to troubleshoot installation failures, Tool errors and non-running jobs in Galaxy. For all the modules presented, we always had a prepared exercise so the training was indeed hands-on.</p> <p>We capped our very productive workshop by going to a bar and restaurant for a celebratory dinner by the harbor. People were playing BINGO when I got there which added to the already-celebrating atmosphere. One of my classmates won a box of essential oils for completing a round! Myself and one of the instructors almost won as well but we failed to shout “BINGO!” as soon as our last missing number was called so the prize was given to someone else! Ahh but it was fun! We all had a great time. <img src="https://s0.wp.com/wp-content/mu-plugins/wpcom-smileys/twemoji/2/72x72/1f642.png" alt="🙂"><a href="https://arundecano.wordpress.com/2018/02/01/coding-in-the-winter-wonderland-galaxy-admin-training-in-oslo-2018/img_20180112_235636_778/"><img src="https://arundecano.files.wordpress.com/2018/02/img_20180112_235636_778.jpg?w=150&amp;h=84" alt=""></a><a href="https://arundecano.wordpress.com/2018/02/01/coding-in-the-winter-wonderland-galaxy-admin-training-in-oslo-2018/img_20180112_235636_781/"><img src="https://arundecano.files.wordpress.com/2018/02/img_20180112_235636_781.jpg?w=150&amp;h=84" alt=""></a></p> <p>We all then took a walk and went back to our own quarters. Many of us had to fly back home the next day but I stayed for the weekend and visited some historical spots in the city. I also took Metro #1 and went all the way to the last station to spend a little time in the Winter Park before the sky turned pitch black again in the afternoon.</p> <p><a href="https://arundecano.wordpress.com/2018/02/01/coding-in-the-winter-wonderland-galaxy-admin-training-in-oslo-2018/#gallery-404-2-slideshow">Click to view slideshow.</a></p> <p>I flew back to Ireland the next day full of these exciting memories and new knowledge about Galaxy server administration.</p> <p>I especially want to thank the Open Bioinformatics Foundation (OBF) Board for choosing me for their <a href="https://news.open-bio.org/2018/01/30/arun-decano-awarded-obf-travel-fellowship/">Travel Award</a> and offering to defray the cost of this wonderful trip! More power to OBF!</p>https://www.open-bio.org/2017/12/15/mailing-list-consolidation/Fri, 15 Dec 2017 19:52:57 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2017/12/15/mailing-list-consolidation/<p>The OBF&rsquo;s self-hosted <a href="https://news.open-bio.org/2017/11/12/mailing-list-outage-and-public-board-meeting-update/">mailman server is still struggling</a> right now, so we are looking at migrating the active mailing lists to paid hosting, and as part of this consolidating down to ideally about a dozen mailing lists. Currently we have a <em>lot</em> of mailing lists, but many are dormant or redundant.</p> <p>Some were announcement specific, where nowadays blogs and Twitter work quite well. Others were development specific (including automatic commit logs from central source code repositories), but now most OBF Project discussions are on GitHub. While the main project mailing lists used to have a lot of user support traffic, much of that has moved to external Q&amp;A style sites like BioStars, StackExchange, or StackOverflow. What this means is that the OBF software projects probably only need a single mailing list each.</p> <p>Based on <a href="http://mailman.open-bio.org/mailman/listinfo">http://mailman.open-bio.org/mailman/listinfo</a> here are the current publicly listed OBF hosted mailing lists.</p> <p>Miscellaneous active public lists (propose to retain in some form):</p> <ul> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bosc-announce/">Bosc-announce</a> - BOSC meeting announcements and updates ( <a href="http://mailman.open-bio.org/pipermail/bosc-announce/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/gsoc/">GSoC</a> - OBF mentors and students for Google Summer of Code ( <a href="http://mailman.open-bio.org/pipermail/gsoc/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/open-bio-l/">Open-Bio-l</a> - Open Bioinformatics Foundation cross-project dev discussion ( <a href="http://mailman.open-bio.org/pipermail/open-bio-l/">archive</a>)</li> </ul> <p>Miscellaneous active but non-public lists (propose to retain in some form):</p> <ul> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bioinfo-core/">bioinfo-core</a> - Managers, Staff, and Scientists of Bioinformatics, Data Science and Research IT core facilities ( <a href="http://mailman.open-bio.org/mailman/private/bioinfo-core/">private archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/gsoc-mentors/">Gsoc-mentors</a> - GSoC - mentors only ( <a href="http://mailman.open-bio.org/mailman/private/gsoc-mentors/">private archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/members/">Members</a> - Communication channel to OBF members ( <a href="http://mailman.open-bio.org/mailman/private/members/">private archive</a>)</li> </ul> <p>BioPerl (propose to merge to a single list):</p> <ul> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bio-phylo-l/">Bio-phylo-l</a> - BioPerl Phylogenetics modules ( <a href="http://mailman.open-bio.org/pipermail/bio-phylo-l/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bioperl-announce-l/">BioPerl-announce-l</a> - Bioperl Project Announcements ( <a href="http://mailman.open-bio.org/pipermail/bioperl-announce-l/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bioperl-dev/">bioperl-dev</a> - BioPerl Developer Core ( <a href="http://mailman.open-bio.org/pipermail/bioperl-dev/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bioperl-guts-l/">BioPerl-guts-l</a> - BioPerl internals &amp; bug reports ( <a href="http://mailman.open-bio.org/mailman/private/bioperl-guts-l/">private archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bioperl-l/">BioPerl-l</a> - Bioperl Project Discussion List ( <a href="http://mailman.open-bio.org/pipermail/bioperl-l/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bioperl-microarray/">bioperl-microarray</a> - Microarrays in BioPerl ( <a href="http://mailman.open-bio.org/pipermail/bioperl-microarray/">archive</a>)</li> </ul> <p>BioJava (propose to merge to a single list):</p> <ul> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biojava-dev/">BioJava-dev</a> - BioJava developers list ( <a href="http://mailman.open-bio.org/pipermail/biojava-dev/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biojava-l/">BioJava-l</a> - Biojava discussion list ( <a href="http://mailman.open-bio.org/pipermail/biojava-l/">archive</a>)</li> </ul> <p>Biopython (propose to merge to a single list):</p> <ul> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biopython/">Biopython</a> - Biopython discussion list ( <a href="http://mailman.open-bio.org/pipermail/biopython/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biopython-announce/">Biopython-announce</a> - Biopython announcements and news ( <a href="http://mailman.open-bio.org/pipermail/biopython-announce/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biopython-dev/">Biopython-dev</a> - Biopython Developers List ( <a href="http://mailman.open-bio.org/pipermail/biopython-dev/">archive</a>)</li> </ul> <p>BioRuby (propose to merge to a single list):</p> <ul> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bioRuby/">BioRuby</a> - BioRuby Project Discussion List ( <a href="http://mailman.open-bio.org/pipermail/bioruby/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bioruby-cvs/">BioRuby-cvs</a> - BioRuby CVS commit notices ( <a href="http://mailman.open-bio.org/pipermail/bioruby-cvs/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bioruby-ja/">BioRuby-ja</a> - BioRuby Project Discussion List (in Japanese) ( <a href="http://mailman.open-bio.org/pipermail/bioruby-ja/">archive</a>)</li> </ul> <p>BioSQL (propose to merge to a single list):</p> <ul> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biosql-guts-l/">BioSQL-guts-l</a> - Commit and Bugzilla messages for BioSQL ( <a href="http://mailman.open-bio.org/pipermail/biosql-guts-l/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biosql-l/">BioSQL-l</a> - BioSQL Discussion List ( <a href="http://mailman.open-bio.org/pipermail/biosql-l/">archive</a>)</li> </ul> <p>EMBOSS (propose to merge to a single list):</p> <ul> <li><a href="http://mailman.open-bio.org/mailman/listinfo/emboss/">EMBOSS</a> - EMBOSS mailing list ( <a href="http://mailman.open-bio.org/pipermail/emboss/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/emboss-announce/">emboss-announce</a> - EMBOSS Announcements (Releases, etc.) ( <a href="http://mailman.open-bio.org/pipermail/emboss-announce/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/emboss-bug/">emboss-bug</a> - EMBOSS Bug Reports and Support Requests ( <a href="http://mailman.open-bio.org/mailman/private/emboss-bug/">private archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/emboss-dev/">emboss-dev</a> - EMBOSS Development Discussion (Open to all) ( <a href="http://mailman.open-bio.org/pipermail/emboss-dev/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/private/emboss-submit/">emboss-submit</a> - EMBOSS submissions - new packages and apps ( <a href="http://mailman.open-bio.org/pipermail/emboss-submit/">private archive</a>)</li> </ul> <p>DAS (propose to merge to a single list, or close and archive):</p> <ul> <li><a href="http://mailman.open-bio.org/mailman/listinfo/das/">DAS</a> - DAS discussion list ( <a href="http://mailman.open-bio.org/pipermail/das/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/das-announce/">DAS-announce</a> - DAS announcement list ( <a href="http://mailman.open-bio.org/pipermail/das-announce/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/das2/">DAS2</a> - DAS2 Discussion List ( <a href="http://mailman.open-bio.org/pipermail/das2/">archive</a>)</li> </ul> <p>Dormant lists, including legacy projects (propose to close and archive):</p> <ul> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biobiz/">BioBiz</a> - Commercial aspects of open source life science code ( <a href="http://mailman.open-bio.org/pipermail/biobiz/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biocorba-announce-l/">Biocorba-announce-l</a> - BioCorba Announcements ( <a href="http://mailman.open-bio.org/pipermail/biocorba-announce-l/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biogroovy-l/">biogroovy-l</a> - biogroovy general discussion list ( <a href="http://mailman.open-bio.org/pipermail/biogroovy-l/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biolib-dev/">BioLib-dev</a> - BioLib Developers List ( <a href="http://mailman.open-bio.org/pipermail/biolib-dev/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/biosoap-l/">Biosoap-l</a> - BioSOAP project ( <a href="http://mailman.open-bio.org/pipermail/biosoap-l/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/bP-announce/">bp-announce</a> - BioPathways Consortium Announcements ( <a href="http://mailman.open-bio.org/pipermail/bp-announce/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/moby-announce/">Moby-announce</a> - MOBY annoucements ( <a href="http://mailman.open-bio.org/pipermail/moby-announce/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/moby-dev/">MOBY-dev</a> - Core developer announcements ( <a href="http://mailman.open-bio.org/pipermail/moby-dev/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/moby-guts/">MOBY-guts</a> - MOBY CVS Commits Log ( <a href="http://mailman.open-bio.org/pipermail/moby-guts/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/moby-l/">moby-l</a> - MOBY discussion list ( <a href="http://mailman.open-bio.org/pipermail/moby-l/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/obf-developers/">obf-developers</a> - Open-Bio.org members with developer access ( <a href="http://mailman.open-bio.org/pipermail/obf-developers/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/ontologies/">Ontologies</a> - Open Bio Ontologies list ( <a href="http://mailman.open-bio.org/mailman/private/ontologies/">private archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/open-bio-announce/">Open-Bio-Announce</a> - OBF announcements ( <a href="http://mailman.open-bio.org/pipermail/open-bio-announce/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/open-bioinformatics-foundation/">Open-Bioinformatics-Foundation</a> - OBF broadcast list ( <a href="http://mailman.open-bio.org/pipermail/open-bioinformatics-foundation/">archive</a>)</li> <li><a href="http://mailman.open-bio.org/mailman/listinfo/Volunteer/">Volunteer</a> - Open-Bio volunteer coordinator ( <a href="http://mailman.open-bio.org/mailman/private/volunteer/">private archive</a>)</li> </ul> <p>If this affects you directly (e.g. any project leaders we have not been able to contact yet), please write to the OBF board. Since mailman is currently unreliable, board at open-bio.org might not work. Please CC our fall back address of obf-board at Google Groups.</p> <p><strong>Update</strong>: Projects can also get in touch via this <a href="https://github.com/OBF/obf-docs/issues/42">GitHub issue</a>.</p>https://www.open-bio.org/2017/11/21/bosc-2017-prague-land-of-stories/Tue, 21 Nov 2017 14:02:57 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2017/11/21/bosc-2017-prague-land-of-stories/<p><em>This is a guest blog post from Farah Zaib Khan, who was supported by the ongoing <a href="https://github.com/OBF/obf-docs/blob/master/Travel_fellowships.md">Open Bioinformatics Foundation travel fellowship program</a> to attend our annual conference BOSC 2017 and its preceding Codefest in Prague, July 2017. The OBF’s Travel Fellowship program continues to help open source bioinformatics software developers with funding to attend conferences or workshops. The current call closes 15 December 2017, you might want to apply?</em></p> <p>So the journey started back in May 2017 when I met <a href="http://www.commonwl.org/">Common Workflow Language (CWL)</a> co-founder,  <a href="https://orcid.org/0000-0002-2961-9670">Michael R. Crusoe</a> during his visit to our University ( <em>University of Melbourne</em>). I have been working with CWL team since 2015 but it was only then we met in person and discussed various aspects of the CWL standard and how we can collaborate to incorporate principles of Provenance modelling to capture retrospective provenance of CWL workflow enactments. We started working on an idea which led to <a href="https://f1000research.com/posters/6-1547">poster submission</a> and acceptance at <a href="https://www.open-bio.org/wiki/BOSC_2017">Bioinformatics Open Source Conference (BOSC) 2017</a>. I was excited as well as nervous (will explain how this changed later :) ). Excited because this was my very first time attending any BOSC and ISMB conference and nervous because of the feeling that the names that you see at the top of high quality research articles will be there and you get to meet and talk to world class scientists doing wonders.</p> <p>Nervous and excited I prepared for all the travelling which involved applying for a visa of course (going to Sydney for that) and arranging accommodation, conference registration, booking plane ticket and finally receiving the visa 7 days before my flight. The Czech Consulate was very professional and kind to process the visa in just 7 working days. I left Melbourne to attend 2-Day OBF Codefest followed by 2-Day BOSC and remaining ISMB conference. My Airbnb host was waiting for me when I reached and welcomed me warmly. She had the whole day planned for us as I reached at 9 am July 19th and the codefest had to commence on July 20th. She was keen to learn about my culture, home country, language and research too :). During the day we roamed around the City, had lunch and she shared information about the Czech history and how late 80&rsquo;s Velvet Revolution changed the economic conditions of the country.</p> <p>In the evening of my first day, I had a dinner with few members of Seven Bridges team and CWL working group (thanks to Michael for arranging this) at an amazing vegan restaurant in the  Old town. We kick started discussion of our work informally during dinner where SevenBridges team introduced their super cool open source toolkit, <a href="http://rabix.io/launch">Rabix</a> for describing the CWL tools workflows. I presented the idea of CWL provenance module which we had planned to work on during the OBF Codefest the very next day. Mostly it was getting to know the teams and getting ready for the next day while enjoying delicious dinner in the heart of Prague Old town.</p> <p>All geared up, next morning I took a subway from the station right next to Congress center to reach <a href="https://brmlab.cz/">Brmlab</a> which is a non-profit hackerspace self supported by community. The transport system of Prague is commendable as despite the signs written Czech, it was quite straight forward to follow Google maps and take the right subways, trams or buses. When I reached, <a href="https://twitter.com/chapmanb">Brad Chapman</a>, <a href="https://twitter.com/matuskalas">Matúš Kalaš</a> and others were already there making arrangements, providing enough extension cables, arranging food (with many vegan friendly options) and making sure everything is in place. There were more than 60 participants for this open collaborative event to build things and discuss future prospects of research together. The day kick started with introductions and organization into groups to work on related projects. This was followed by coffee and local produce (fruits, bread and pastries) break where people carried on with individual introductions and conversations.</p> <p>[caption id=&ldquo;attachment_1782&rdquo; align=&ldquo;aligncenter&rdquo; width=&ldquo;378&rdquo;]<img src="https://news.open-bio.org/wp-content/uploads/2017/11/DSC_0553-300x169.jpg" alt=""> &ldquo;Breakfasting&rdquo; in open air outside the lab. Image was originally shared <a href="https://photos.google.com/share/AF1QipNQrGZitpC7yhTozyeX6dWnV5IZzhx1G-fJgkQWfvNpZiwj49qGmPN6azx5gJ7eLg?key=ZTJwdmtGdkV3dGlZWXlZYlg5a2hqaTNkMXRUWkVR">here</a>.[/caption]</p> <p>Various groups started working on different projects from 10 am to 1 pm. These projects include <a href="http://multiqc.info/">MultiQC</a>, <a href="http://biopython.org/">biopython</a>, <a href="https://www.nextflow.io/">nextflow</a>,  <a href="https://github.com/johnfonner/cwltool/tree/feature-singularity">Singularity support in CWL</a>,  <a href="https://github.com/common-workflow-language/cwltool/tree/provenance">Provenance support in CWL</a>,  <a href="https://github.com/common-workflow-language/python-cwlmodel">CWL SDK</a> and <a href="http://rabix.io/launch">Rabix</a>. Our group led by <a href="https://twitter.com/soilandreyes">Stian Soiland-Reyes</a> started working on Provenance analysis and had a very useful discussion about what to capture from a workflow run retrospectively and how to structure the Provenance of a CWL workflow run. To start with, we decided to include a provenance module in reference implementation <a href="https://github.com/common-workflow-language/cwltool/tree/master/cwltool">cwltool</a> developed by CWL team. Nervously I started but now it felt like home and we got to work during 10am-1pm work window. I had guidance through out this time by people around me and I would like to thank them once more :) .</p> <p>[caption id=&ldquo;attachment_1784&rdquo; align=&ldquo;aligncenter&rdquo; width=&ldquo;446&rdquo;]<img src="https://news.open-bio.org/wp-content/uploads/2017/11/DSC_0582-300x169.jpg" alt=""> Work in Progress for 10am-1pm session[/caption]</p> <p>At 1 pm, we took a lunch break but before going for lunch break all the groups gathered and presented their progress so far. A round of applause for the organizers and sponsors who kept the supply of coffee running through out the day. The lunch was delicious pizza with local flavored soft drinks. Again all dietary requirements were accounted for and everyone seemed to enjoy &quot; <em>across-group</em>&quot; discussion and food. After lunch break the group gathered again and started working from 2 pm to 6 pm before leaving for the group dinner. We kept working on our project idea and all the groups reported at 6 pm presenting their progress and headed out for the group dinner. Our group stayed back as Brad graciously offered to stay back if someone wants to continue working. Luckily brmlab was also open 24/7 so we kept working till 9 pm. Late night dinner and headed to the apartment taking the same subway. The city was awake and happening even later in the night. At last the first very productive day came to an end.</p> <p>July 21st was the second and last day of the Codefest. On my way to brmlab, I stopped at <a href="https://www.copygeneral.cz/">Copy General</a> to get the print of my poster which was required to be displayed the next day. I must admit the staff at this shop was very professional and helpful. They made sure I get the right size of my poster (as it was in landscape orientation) and were quite flexible about the pick up time. Getting done with this important task, I was relaxed and headed to the lab for second day of codefest. The day followed the same pattern as July 20th starting with projects&rsquo; updates, plans to be followed for the day followed by coffee and breakfast. Our organizers collected some best quality local produce from a farmer&rsquo;s market and kept everything organized efficiently.</p> <p>We further worked on the implementation of a basic Research Object generation as a result of CWL workflow run. By the lunch time we were able to complete the set goals and presented out progress. Everyone was excited and engaged in working with their groups and contributing in every way they could. At 6 pm every group leader wrapped up their progress through out these two days and everyone participated in cleaning the space as it is a community-run space shared by everyone. At the end of these two amazing days, I looked back and realized I was nervous for nothing. As Brad Chapman says and  I quote <strong>&quot; <em>BOSC is all about getting people together and learning from each other&quot; .</em></strong></p> <p>I don&rsquo;t think anyone can disagree with this statement and the idea of community led projects and open source bioinformatic software feels real and in practice when one interacts and participates in events like OBF-Codefest and BOSC. The codefest ended with dinner at Zly cafe near the Congress center where the next four days are scheduled.</p> <p>[caption id=&ldquo;attachment_1787&rdquo; align=&ldquo;aligncenter&rdquo; width=&ldquo;482&rdquo;]<img src="https://news.open-bio.org/wp-content/uploads/2017/11/DSC_0614-300x169.jpg" alt=""> Dinner at Zly Cafe[/caption]</p> <p>New day, new tasks.. July 22nd was the first day of BOSC 2017 and at the same time all the posters were required to be hanged in the morning. I rushed to the copy general to collect my poster which was ready the same day. On my way to the shop I met loving and most friendly <a href="https://twitter.com/monimunozto">Monica Munoz-Torres</a> from UC Berkeley who was volunteering as part of organizing committee (presenting Apollo later as well) and was headed to the same copy center. We had good conversation about open source bioinformatics initiatives and her work as volunteer organizing BOSC which she calls her favorite conference :) .</p> <p>Rushed back to the Congress center, arranged the poster on its designated location along with 100s of amazing posters and headed to attend BOSC opening talks. I was impressed by OBF progression and their support for researchers by providing <a href="https://news.open-bio.org/2016/03/01/obf-travel-fellowship-program/">OBF Travel scholarship</a> and participation in organizing Google summer code camps. Brad presented the summary of Codefest afterwards which had a slide we prepared for our part of work [Provenance Support in CWL]. There were many talks related to CWL application and usage during the whole day. Rabix composer, Rabix Executor, CWL Viewer, bcbio and many more CWL oriented work was presented. We organized a Birds of a feather session during lunch time to discuss <em>what should be captured in a Research Object when a CWL workflow is enacted</em>. This session initiated interesting discussion about different levels and views of Provenance.</p> <p>In the afternoon Björn Grüning&rsquo;s talk was very interesting where he empathized on <strong>Findability, Accessibility, Interoperability, and Reusability (FAIR)</strong> principles for tool deployment and resolving tool dependencies using package managers as Conda and BioConda. Later during this and next day <a href="https://twitter.com/search?q=%23BOSC2017%20FAIR%20bingo&amp;src=typd">FAIR bingo</a> became a real thing as part of most of the talks. The highlight of the day was indeed the key note speech <em>&ldquo;Open Sourcing Ourselves&rdquo;</em> by <a href="http://www.madeleineball.net/">Madeleine Ball</a> who is working on the project <a href="https://www.openhumans.org/">Open Humans</a>. She discussed inspiring Dana Lewis&rsquo;s story who is creator of &ldquo;Do-It-Yourself Pancreas System&rdquo; and made her own continuous glucose monitor alarms louder further leading to the foundation of OpenAPS.</p> <p>On the second day of BOSC, we had more talks and updates  starting with the key note speech &quot; <em>Bioinformatics for Personalized Medicine: Looking Beyond the Genome</em>&quot; by <a href="http://epigenomics.cemm.oeaw.ac.at/meg/">Christoph Bock</a>. He presented few examples from cancer research explaining how epigenomic mutations can be mapped to identify the various aspects of cancer. The topic was of my personal interest and indeed very informative. The ultimate goal is to make the dream of personalized medicine a reality using the available technologies including use of CRISPR for modelling epigenomic factors.</p> <p>After the key note speech I attended Monica Munoz-Torres&rsquo;s talk about <em><a href="http://apollo.berkeleybop.org/">Apollo</a></em>, collaborative genomic annotation editor that automatically synchronizes the work of geographically separated research community and establishes a network between the researchers, more like a social network for curators according to Monica. The huge user base working on different genomes interact using Apollo and share the curated genomes. The next talk by  Pjotr Prins was about <em>Journal of Open Source Software (JOSS)</em> , an initiative all available on <a href="https://github.com/openjournals/joss">GitHub</a> for accrediting academic software equipped with documentation.  In this way, software engineers can publish their software without getting to write a paper about it. It will facilitate the users as the software will be better documented when intended to be published.</p> <p>Another impressive talk was about &quot; <em>Distance-based, online bioinformatics training in Africa: the H3ABioNet experience&quot;</em> by Nocola Mulder from University of Cape Town. She described the efforts made to bring bioinformatics training to all the places in Africa using a distributed classroom model. Due to internet connectivity issues and other factors, the lectures were recorded beforehand. The lectures were delivered live (online) as well but if there is a connectivity issue, the recordings were available. In addition, various practical assignments were designed to enhance the learning experience. The combination of live lectures, online classes, recordings and practical exercises together results in connectivity and highly interactive environment. Another highlight from the session was release of open source variant calling toolkit <a href="https://software.broadinstitute.org/gatk/download/beta">GATK4</a> coupled with <a href="https://software.broadinstitute.org/wdl/">WDL</a> and Cromwell.</p> <p>There were many more talks that I attended and enjoyed such as talk by Ted Liefeld about <a href="http://www.genomespace.org/">GenomeSpace</a>, Kai Blin about <a href="https://bitbucket.org/antismash/antismash">anitSMASH</a> and Kenzo-Hugo Hillion about <a href="http://docs.biothings.io/en/latest/">BioThings SDK</a>. Oh and during lunch time I attended the BoF session organized by JOSS (was intrigued after listening to the presentation earlier). Later in the day, the panel discussion was worth attending chaired Madeleine Ball, Prof. <a href="http://www.manchester.ac.uk/research/Carole.goble/">Carole Goble</a>, <a href="http://sulab.org/">Andrew Su</a> and <a href="http://lab.loman.net/">Nick Loman</a>. Carole Goble&rsquo;s point made perfect sense that the young scientists although are willing to share the data and are open to collaborations where as senior scientists (PIs) consider it more effort  with less rewarding results.</p> <p>Day 2 ended with an amazing closing key note speech by <a href="http://lab.loman.net/">Nick Loman</a> who discussed  virus outburst surveillance using the Oxford nanopore minION sequencing technology, using two examples, namely Ebola outburst in Africa in 2015 and the Zika virus in Brazil. &ldquo;If you can&rsquo;t move the subjects and samples to the sequencer, bring the sequencer to the subject&rdquo;.</p> <p>Oh wait the day actually ended with an end of BOSC dinner ..</p> <p><img src="https://news.open-bio.org/wp-content/uploads/2017/11/DFcPys3WsAIhebp-169x300.jpg" alt=""></p> <p>but before that we stopped at <a href="https://academic.oup.com/gigascience">GigaScience</a>&rsquo;s 5th birthday for cake and free GOT themed <em>&ldquo;Data is coming&rdquo;</em> T shirt which they graciously saved ^_^  (because I reached late). Why did I reach late?</p> <p>Yes I was there for a poster presentation :) . The poster presentation was from 6-7 pm and was a terrific experience talking about my work and progress we made during code fest earlier.</p> <p><img src="https://news.open-bio.org/wp-content/uploads/2017/11/21294979_893002990907345_5610908708142841856_n-300x300.jpg" alt=""></p> <p>All in all, everything was amazing, the people, the venue, the city, the knowledge gain, the help you get from peers, the encouragement from fellow researchers. Remember the  nervousness I mentioned at the beginning of this post ? ALL GONE after this fruitful experience. Few things that might be helpful in future: We should work towards resolving the issue of gender imbalance that was seen (and usually seen in conferences), discussed and acknowledged during Code fest and BOSC.  I think we can advertise the Codefest and the objectives in more detail so people can attend even if they don&rsquo;t have a group there to start with. This is by no means a complaint or criticism, just something I observed and felt as there were 3 female participants out of &gt;60 total participants of Codefest. I think in future we can make this better and advertise about the welcoming environment of Codefest and BOSC.</p> <p>Thanks to <a href="https://www.open-bio.org/wiki/Main_Page"><strong>OBF</strong></a> for covering my air fare by refunding through OBF travel funding. I would also like to thank <a href="http://daspos.org/">Data and Software Preservation for Open Science</a> ( <strong>DASPOS</strong>) (working in developing workflow and provenance tracking for high energy physics) for covering the rest of conference related expenses . In the end, this post will be incomplete if I don&rsquo;t thank <em>Michael Crusoe</em> for the mentoring, encouragement, guidance, all the support, connecting me with DASPOS and providing prompt feedback whenever I ask :) .</p> <p><strong><em>Need a shorter version and more pictures</em></strong>?? &ndash;&gt; <a href="//storify.com/farahzk03/bosc-2017-in-the-land-of-stories">View the story &ldquo;BOSC-2017 in the Land of stories&rdquo; on Storify</a></p> <p>P.S. Some other day, I might write about wandering experience in Prague Castle, Old Town, Charles Bridge, local wooden sovereigns, amazing food especially Goats cheese and of course&hellip; lemonades :) .</p>https://www.open-bio.org/2017/11/12/mailing-list-outage-and-public-board-meeting-update/Sun, 12 Nov 2017 09:50:20 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2017/11/12/mailing-list-outage-and-public-board-meeting-update/<p>This time of year we&rsquo;d normally be having a public board meeting as part of our commitment to communication with our member projects and the wider OBF community. As per our bylaws we notify the community at least 10 days in advance, and we&rsquo;d also handle election of new board members and leadership changes where appropriate. For a couple of reasons, we&rsquo;re going to postpone that until early 2018.</p> <p>Our mailing list server (which hosts many of our member project lists) has been overwhelmed in the past few days, leading to delayed or blocked communication not just to our members but for our member projects who rely on it. We&rsquo;re looking into options for solving this problem, which might include migrating to a hosted solution.</p> <p>This comes at the same time that the OBF board has been taking a look at how best to direct the organisation as we move forward. We&rsquo;d like to have that conversation with our members <em>after</em> we&rsquo;ve crystallised our thoughts a bit, and we&rsquo;re still in the process of doing that.</p> <p>As we&rsquo;re sorting this out, we decided to push the public meeting back to early 2018 so everyone involved can get the most out of it. We hope you understand, and we&rsquo;re looking forward to hearing from as many of you as we can at that meeting.</p>https://www.open-bio.org/2017/09/05/biopython-on-podcastinit/Tue, 05 Sep 2017 16:17:08 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2017/09/05/biopython-on-podcastinit/<p><a href="https://www.podcastinit.com/">Podcast.__init__</a> describes itself as <em>&ldquo;The Podcast About Python and the People Who Make It Great&rdquo;</em>, and the most recent episode is &quot; <a href="https://www.podcastinit.com/biopython-with-peter-cock-wibowo-andrarto-and-tiago-antao-episode-125/">Biopython with Peter Cock, Wibowo Arindrarto, and Tiago Antão (Episode 125)</a>&quot;.</p> <p>Listening to the finished podcast, interviewer Tobias Macey did a great job. There are things I would have liked to have said - but it turned out pretty well. I hope you&rsquo;ll agree:</p> <p>Its worth looking back over the podcast archives, here are a few that caught my eye:</p> <ul> <li><a href="https://www.podcastinit.com/coverage-py-with-ned-batchelder-episode-121/">Coverage.py with Ned Batchelder (Episode 121)</a></li> <li><a href="https://www.podcastinit.com/episode-105-scikit-image-with-stefan-van-der-walt-and-juan-nunez-iglesias/">Scikit-Image with Stefan van der Walt and Juan Nunez-Iglesias (Episode 105)</a></li> <li><a href="https://www.podcastinit.com/episode-98-pandas-with-jeff-reback/">Pandas with Jeff Reback (Episode 98)</a></li> </ul>https://www.open-bio.org/2017/08/28/obf-travel-fellowship-jonathan-sobel/Mon, 28 Aug 2017 14:43:53 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2017/08/28/obf-travel-fellowship-jonathan-sobel/<p><em>This blog post is syndicated from a <a href="https://jonathansobel1.wordpress.com/2017/07/27/bosc-session-of-the-eccbismb-2017/">post on Jonathan Sobel&rsquo;s blog</a>, originally published July 27, 2017. Jonathan was supported by the ongoing <a href="https://github.com/OBF/obf-docs/blob/master/Travel_fellowships.md">OBF travel fellowship program</a> to attend the 2017 Bioinformatics Open Source Conference (BOSC), held as part of the 2017 ISMB/ECCB meeting in Prague, Czech Republic, in July 2017.</em> <em>The OBF&rsquo;s Travel Fellowship program continues to help open source bioinformatics software developers with funding to attend conferences, workshops, or training events. The next call closes 15 December 2017.</em></p> <p>As the lucky recipient of an <a href="https://www.open-bio.org/wiki/Main_Page">Open Bioinformatics Foundation (OBF)</a> travel grant, I had the chance to attend to my first <a href="https://www.open-bio.org/wiki/BOSC_2017">Bio-informatics Open Source Conference (BOSC)</a> in Prague the 21 and 22 July 2017.</p> <p><img src="https://jonathansobel1.files.wordpress.com/2017/07/pear.png?w=164&amp;h=117" alt="Pear"></p> <p>During the event, I discovered an amazing community of scientists and developers involved in the field of bioinformatics, with a strong open source mindset. “Sharing is caring” and I can tell these guys care a lot! The first day was quite technical with several talks about projects developed during the <a href="https://www.open-bio.org/wiki/Codefest_2017">code fest</a> that happen just prior to the conference. I had the opportunity to discover the <a href="https://www.nature.com/articles/sdata201618">FAIR principles</a> (Findability, Accessibility, Interoperability, and Reproducibility) of open data, and several tools aimed at simplifying bioinformatics workflow sharing, visualizing and production. These teams triggered my curiosity towards the <a href="http://www.commonwl.org/draft-3/UserGuide.html">Common Workflow Language</a> (CWL) and data standards, notably <a href="http://rabix.io/">RABIX</a>, <a href="http://ga4gh.org/#/">GA4GH</a> and <a href="https://www.nextflow.io/index.html">nextflow</a>. Several talks presented very useful tools such as <a href="https://github.com/alesssia/YAMP">YAMP</a> (Yet Another Metagenomic Pipline!) or <a href="http://multiqc.info/">MiltiQC</a> for next generation sequencing quality control, and <a href="https://www.openms.de/">Open MS 2.0</a> for mass-spectrometry data analysis. One important topic of the day was the reproducibility of bioinformatics piplines and several talks were addressing this question with various approaches, such as containers (Dockers, <a href="https://biocontainers.pro/">BioContainers</a>), <a href="https://www.gnu.org/software/guix/">GNU Guix</a> or package repository such as <a href="https://bioconda.github.io/">BioConda</a>.</p> <p><img src="https://jonathansobel1.files.wordpress.com/2017/07/logo.png?w=339&amp;h=168" alt="logo"></p> <p>On the second day, I had the chance to present our <a href="http://www.genome.beer/">BeerDeCoded</a> project in the Citizen Science session of the BOSC. I had the first slot in the morning with an audience of nearly 250 attendees. The beer topic is kind of holy in a geek environment. I had the pleasure to share several important message regarding science conducted outside of academia or industry, in a community laboratory space like <a href="http://www.hackuarium.ch/en/">Hackuarium</a>. I put some emphasis about science communication between fields and outside of our institutional scientific community. As experts, we have the responsibility to make our knowledge and our researches accessible to a wide audience, and this is exactly our goal with BeerDeCoded and Hackuarium. In addition, I could announce <a href="https://github.com/beerdecoded/Beer_ITS_analysis">the official release</a> of our first results based on the metagenomic analysis of <a href="https://www.ncbi.nlm.nih.gov/bioproject/PRJNA388541/">39 beer samples</a>. I was able to show our preliminary analysis. The BOSC community was really enthusiastic about the project and attendees tweeted quite a lot about it.</p> <blockquote> <p>Some background material for <a href="https://twitter.com/JonathanSobel1">@JonathanSobel1</a>&rsquo;s &ldquo;BeerDeCoded&rdquo; talk at <a href="https://twitter.com/hashtag/BOSC2017?src=hash">#BOSC2017</a><img src="https://s0.wp.com/wp-content/mu-plugins/wpcom-smileys/twemoji/2/72x72/1f37a.png" alt="🍺"> <a href="https://t.co/O52PI6k1hT">pic.twitter.com/O52PI6k1hT</a></p> <p>— Madeleine Price Ball (@madprime) <a href="https://twitter.com/madprime/status/889038522836975616">July 23, 2017</a></p> </blockquote> <blockquote> <p>The scientific method reloaded: Analyse data, think, drink, repeat. <a href="https://twitter.com/hashtag/BOSC2017?src=hash">#BOSC2017</a> <a href="https://t.co/JY0sLuXtzw">pic.twitter.com/JY0sLuXtzw</a></p> <p>— Bastian Greshake (@gedankenstuecke) <a href="https://twitter.com/gedankenstuecke/status/889038120691392513">July 23, 2017</a></p> </blockquote> <blockquote> <p>Work in progress for <a href="https://twitter.com/beerdecoded">@beerdecoded</a> – really really want <a href="https://twitter.com/nanopore">@nanopore</a> (so do we!) <a href="https://twitter.com/hashtag/BOSC2017?src=hash">#BOSC2017</a> <a href="https://twitter.com/hashtag/ISMBECCB?src=hash">#ISMBECCB</a> <a href="https://t.co/FplOglIpb0">pic.twitter.com/FplOglIpb0</a></p> <p>— BauhiniaGenome (@BauhiniaGenome) <a href="https://twitter.com/BauhiniaGenome/status/889039041215303680">July 23, 2017</a></p> </blockquote> <p>In addition, I had some very interesting questions about the interest of breweries in BeerDeCoded, the potential fear of companies that citizen scientist decode their proprietary yeast strain or about the data integration of sequencing with GC/MS in order to study small molecules present in our beer data-set. Moreover, this talk will potentially trigger new collaborations with with Bérénice Batut from the <a href="https://galaxyproject.org/teach/gtn/">Galaxy training network</a>.  <a href="https://usegalaxy.org/">Galaxy</a> is an open source, web-based platform for data intensive biomedical research. The Galaxy platform regroups a collection of bioinformatics tools and workflow that can be run without coding knowledge. This program is widely used by biologists to analyze their next generation sequencing data. BeerDeCoded will benefit from this collaboration with a specific instance of Galaxy to make the beer metagenomics accessible to anyone.</p> <p>Later during this second day, I was impressed by several other talks. One of the greatest initiative is the work of the <a href="http://www.h3abionet.org/">H3ABioNet</a>, which aim at training bioinformaticians in Africa. I discovered the <a href="http://joss.theoj.org/about">Journal of open source software</a> (JOSS) that facilitate the publication of bioinformatics software. Then, <a href="http://biothings.io/#">BioThings</a> SDK and <a href="https://www.wikidata.org/wiki/Wikidata:Main_Page">Wikidata</a> presented their API and their knowledge base that allows retrieving efficiently some annotations of biological data. This day was as well the occasion to discuss about data sharing of human data (wearable, clinical, etc.) in order to improve precision medicine and the ethical implication. In addition, second-hand data usage and the problem of re-digitalization of published data in a non-machine readable format was evoked. Finally, Nick Loman gave the closing keynote presentation at BOSC. He gave a great talk about virus outburst surveillance using the Oxford nanopore minION sequencing technology, using two examples, namely Ebola outburst in Africa in 2015 and the Zika virus in Brazil.</p> <p>In summary my first BOSC experience was very intense and highly interesting. I met with great scientists and developers and I learned about the newest open source software/library/API and practices in this field. I would like to thank once again the BOF committee for allowing me to join this great event and to give me the opportunity to present Hackuarium and the BeerDeCoded project.</p> <blockquote> <p><a href="https://twitter.com/hashtag/bosc2017?src=hash">#bosc2017</a> cheers! Thanks for this great conference <a href="https://t.co/m6oO8Wbbky">pic.twitter.com/m6oO8Wbbky</a></p> <p>— Jonathan Sobel (@JonathanSobel1) <a href="https://twitter.com/JonathanSobel1/status/889229547102666752">July 23, 2017</a></p> </blockquote> <p><a href="http://feeds.wordpress.com/1.0/gocomments/jonathansobel1.wordpress.com/73/"><img src="http://feeds.wordpress.com/1.0/comments/jonathansobel1.wordpress.com/73/" alt=""></a></p>https://www.open-bio.org/2017/08/27/obf-travel-fellowship-vitalina-kirgizova/Mon, 28 Aug 2017 02:21:27 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2017/08/27/obf-travel-fellowship-vitalina-kirgizova/<p><em>This blog post is syndicated from a <a href="https://vitalinabiology.com/2017/06/06/bioinformatics-training-course/">post on Vitalina Kirgizova&rsquo;s blog</a>, originally published June 6, 2017. Vitalina was supported by the ongoing <a href="https://github.com/OBF/obf-docs/blob/master/Travel_fellowships.md">OBF travel fellowship program</a> to attend bioinformatics training course held at the Instituto Gulbenkian de Ciência, Oeiras, Portugal, in November 2016.</em> <em>The OBF&rsquo;s Travel Fellowship program continues to help open source bioinformatics software developers with funding to attend conferences, workshops, or training events. The next call closes 15 December 2017.</em></p> <p>Better late than never. On November 2016 I participated at the training course- <a href="ftp://gtpb.igc.gulbenkian.pt/bicourses/2016/AAIRR16/index.html">Analysis of Adaptive Immune Receptor Repertoires using high throughput sequencing data (NGS)</a>. Many thanks for invitation for <a href="http://gtpb.igc.gulbenkian.pt/bicourses/index.html">Pedro Fernandes</a>, who organizes bioinformatic training courses during 20 years! On the basis of the Instituto Gulbenkian de Ciência, Oeiras, Portugal we could go deep into the jungle of algorithms for the analysis of antibody and TCR genes. Our instructor Dr <a href="http://www.vet.cam.ac.uk/directory/sdf22@cam.ac.uk">Simon Frost</a> from University of Cambridge, U.K., made journey exciting and interesting.</p> <p>And I specially want to thank <a href="https://news.open-bio.org/about/">Open Bioinformatics Foundation</a> for supporting my participation!</p> <p><img src="https://vitalinabiology.files.wordpress.com/2016/12/img_0184.jpg?w=700" alt="img_0184"></p> <p>At the IGC bioinformatic class. (Ph Pedro Fernandes)</p> <p>Antibodies, also called immunoglobulins, are large Y-shaped proteins. They are produced by B -cells which function to identify and help remove foreign targets such as viruses, bacteria without damaging the rest of the body.</p> <p>The T-cell receptor, or TCR, is a molecule found on the surface of T cells, that is responsible for recognizing fragments of antigen as peptides bound to major histocompatibility complex (MHC) molecules. T-lymphocytes protect our body from cancer invasions and viruse infections.</p> <p>Each antibody or TCR binds one unique molecule, just as the key fits into the lock. A human can probably make more than 1 000 billion different adaptive immune receptors molecules – it is adaptive immune receptor repertoire.</p> <p><img src="https://vitalinabiology.files.wordpress.com/2016/12/04-t-limfocit-i-kljuch.png?w=700" alt="04-t-limfocit-i-kljuch"></p> <p>Cute T-lymphocyte holds key – T-Cell Receptor (TCR). (Illustration- me)</p> <p>Immunoglobulins are proteins, and proteins are encoded by genes. Randomized combination inherited gene segments – V(D)J recombination of DNA and somatic hypermutation are the primary mechanisms diversification of the human antibody repertoire. High-throughput sequencing (HTS) enables thorough investigation of the diverse immune receptors that determine the specificity of adaptive immunity responses.</p> <p><img src="https://vitalinabiology.files.wordpress.com/2017/06/14947862_1110768205708694_5847757213665972751_n.jpg?w=700" alt="14947862_1110768205708694_5847757213665972751_n"></p> <p>Sweet immuno- bioinformatic November</p> <p>I had an experience in repertoire analysis before. I use software developed at the laboratory where I’m currently working <a href="https://milaboratory.com">MiLaboratory</a>. Also I coauthored a paper reporting the software for immune receptor analysis <a href="https://vitalinabiology.com/publications/">VDJtools</a>.</p> <p><img src="https://vitalinabiology.files.wordpress.com/2016/12/img_0185-1.jpg?w=700" alt="img_0185-1"></p> <p>Our international team. Dr Simon Frost (course instructor) at the left. (Ph Pedro Fernandes)</p> <p>Nevertheless practical course give me an opportunity to develop my knowledge, try different solutions and protocols: IgBLAST, pRESTO, Change-O, etc.,  Also this was the first time when I worked with very useful software tool <a href="http://jupyter.org">Jupyter Notebook</a>. It helps to manage the code and looks very attractive for bioinformatician who grew up from a wet-laboratory (i.e. for me).</p> <p>I have a great time at Portugal. The community of the researchers whom use the immune receptor repertoire analysis in daily routine is not very large. This is very specific and complicate topic because of peculiar nature of the lymphocyte receptor rearrangement. So bioinformatic course was a perfect opportunity for me to accumulate knowledge directly from highly skilled professionals.</p> <p><img src="https://vitalinabiology.files.wordpress.com/2017/06/snapseed-1.jpg?w=700" alt="Snapseed (1)"></p> <p>After another one hard day at the bioinformatic course. With Simon Frost and Pedro Fernandes, bioinformatics training coordinator, at the left)</p> <p><a href="http://feeds.wordpress.com/1.0/gocomments/vitalinabiology.wordpress.com/868/"><img src="http://feeds.wordpress.com/1.0/comments/vitalinabiology.wordpress.com/868/" alt=""></a><img src="https://pixel.wp.com/b.gif?host=vitalinabiology.com&amp;blog=121300637&amp;post=868&amp;subd=vitalinabiology&amp;ref=&amp;feed=1" alt=""></p>https://www.open-bio.org/2017/04/13/bosc-2017-keynote-speakers/Thu, 13 Apr 2017 10:28:24 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2017/04/13/bosc-2017-keynote-speakers/<p>We’re delighted to announce the keynote speakers for the <a href="https://www.open-bio.org/wiki/BOSC_2017">Bioinformatics Open Source Conference, BOSC 2017</a>, and our first sponsors.</p> <p>But first a final reminder - today (Thursday 13 April 2017) is our deadline for submitting a full length talk abstract to BOSC 2017.</p> <h2 id="dawn-field">Dawn Field</h2> <p><img src="https://news.open-bio.org/wp-content/uploads/2017/04/Dawn_Field-e1492000853658-253x300.jpg" alt="">Dawn Field is a Lamberg International Guest Professor at Göteborg University’s Department of Marine Sciences. Previously she was a senior research fellow at the NERC Centre for Ecology and Hydrology, Head of the Molecular Evolution and Bioinformatics Group at the Centre for Ecology and Hydrology in Wallingford, UK, and a research associate at the Smithsonian Institution. She is also a founder of the Genomic Standards Consortium, the Genomic Observatories Network and Ocean Sampling Day.</p> <p>Dr. Field is credited with introducing the concept of a biological code, or &ldquo;biocode&rdquo; - the sum of all DNA on earth. In their book <a href="https://global.oup.com/academic/product/biocode-9780199687756">Biocode: The New Age of Genomics</a>, she and coauthor Neil Davies describe the rapid rise of genomics, how it is revealing the scale and diversity of life on Earth, and future possibilities and implications.</p> <p>Dr. Field&rsquo;s advocacy for open data and interoperability is epitomized by her past leadership of the Genomics Standards Consortium ( <a href="http://gensc.org/about-gsc/">GSC</a>), which aims to facilitate genomic data integration, discovery and comparison through international community-driven standards.</p> <p>The title of Dr. Field&rsquo;s keynote talk is &ldquo;Understanding the Biocode: Global Sharing of Data.&rdquo;</p> <h2 id="nick-loman">Nick Loman</h2> <p><a href="http://lab.loman.net/about/">Nick Loman</a> <a href="http://lab.loman.net/about/"><img src="https://news.open-bio.org/wp-content/uploads/2017/04/Nick-Loman-199x300.jpg" alt=""></a> is known as a vocal proponent of open genomic data in healthcare. A Professor of Microbial Genomics and Bioinformatics at the University of Birmingham, Dr. Loman explores the use of cutting-edge genomics and metagenomics approaches to human pathogens. He promotes the use of open data to facilitate the surveillance and treatment of infectious disease.</p> <p>Dr. Loman helped establish real-time genomic surveillance of Ebola in Guinea and Zika in Brazil (via the <a href="http://www.zibraproject.org/">ZiBRA project</a>, which states that &ldquo;Data will be subject to open release as it is generated&rdquo;). In another recent project, real-time genomic data was used to analyze a small outbreak of Salmonella enteritidis in the UK. Through this sharing of genomic datasets, researchers were able to confirm that the cases were linked to a larger, national-scale outbreak. Dr. Loman is one of the authors of <a href="https://poretools.readthedocs.io/">Poretools</a>, and he regularly shares cutting-edge Nanopore data and protocols for using it. In collaboration with Lex Nederbragt, Dr. Loman is developing an open-source repository of sequencing and bioinformatics benchmarking datasets called <a href="http://lab.loman.net/high-throughput%20sequencing/e.%20coli%20o104%20h4/genomics/2012/10/09/seqbench-a-useful-meta-resource-of-e-coli-sequence-reads/">Seqbench</a>.</p> <h2 id="bosc-2017-sponsors">BOSC 2017 Sponsors</h2> <p>We are grateful to and welcome <a href="http://thehyve.nl/">The Hyve</a> (open source solutions for bioinformatics) and <a href="https://science.mozilla.org/">Mozilla Science Lab</a> (a community of researchers, developers, and librarians making research open and accessible), as the first sponsors for BOSC 2017.</p> <p><a href="http://thehyve.nl/"><img src="https://news.open-bio.org/wp-content/uploads/2017/04/thehyve-logo01-without-shadow.png" alt=""></a><a href="https://science.mozilla.org/"><img src="https://news.open-bio.org/wp-content/uploads/2017/04/MSLLogo.png" alt=""></a></p> <p>If you would like to be a sponsor of BOSC, please contact us at <a href="mailto:bosc@open-bio.org">bosc@open-bio.org</a>.</p>https://www.open-bio.org/2017/04/05/obf-travel-fellowship-anton-khodak/Wed, 05 Apr 2017 19:01:00 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2017/04/05/obf-travel-fellowship-anton-khodak/<p><em>This is a guest blog post from Anton Khodak, who was supported by the ongoing <a href="https://github.com/OBF/obf-docs/blob/master/Travel_fellowships.md">Open Bioinformatics Foundation travel fellowship program</a> to attend a week long <a href="http://www.commonwl.org/">Common Workflow Language (CWL)</a> workshop in London, November 2016. This was a natural continuation of Anton&rsquo;s work on <a href="https://anton-khodak.github.io/argparse2cwl-blog/2016/08/11/gentle-introduction.html">porting tools to the CWL</a> as one of the <a href="https://www.open-bio.org/2016/04/25/welcome-gsoc-2016-students/">OBF&rsquo;s Google Summer of Code 2016 students</a>.</em> <em>The OBF&rsquo;s Travel Fellowship program continues to help open source bioinformatics software developers with funding to attend conferences or workshops. The current call closes 15 April 2017 - if you&rsquo;re planning to attend the OBF&rsquo;s annual <a href="https://www.open-bio.org/wiki/BOSC_2017">Bioinformatics Open Source Conference (BOSC) 2017 in Prague</a>, you might want to apply?</em></p> <h1 id="cwl-week-in-london">CWL week in London</h1> <p>( <a href="https://anton-khodak.github.io/argparse2cwl-blog/2017/03/17/cwl-hackathon.html">Originally published Mar 17, 2017</a>)</p> <p>After the successful completion of my GSoC projects, I had been invited to meet my mentors <a href="https://orcid.org/0000-0002-2961-9670">Michael R. Crusoe</a> and <a href="https://se.linkedin.com/in/romanvg">Roman Valls Guimera</a> for the CWL work session that took place in London from the 1st to the 4th of November, 2016. I was thrilled by this opportunity, and though it took quite a while for me to organize this journey (my first solo voyage abroad), it was undoubtfully worth it.</p> <p>I arrived in London a little earlier to take part in <a href="https://mozillafestival.org/">Mozilla Festival 2016</a> together with Roman. At the festival, I presented my summer projects to people from the bioinformatics community who participated in Mozfest’s <a href="https://app.mozillafestival.org/#_space-open-science">Open Science Fair</a>.</p> <p>The CWL week started a day later. The attendees were Michael (Common Workflow Language project), Roman (the Wolfson Wohl Cancer Research Centre), <a href="https://rs.linkedin.com/in/jsimonovic">Janko Simonovic</a> and <a href="https://rs.linkedin.com/in/ivanbatic">Ivan Batic</a> from Seven Bridges Genomics, <a href="https://orcid.org/0000-0001-9795-7981">Niels Drost</a> from the Netherlands eScience Center, <a href="https://uk.linkedin.com/in/robert-sugar-90b8b941">Robert Sugar</a> from Intel Health and Life Sciences, and myself. During these four days, I worked on polishing the tools I developed ( <a href="https://github.com/erasche/argparse2tool">argparse2tool</a>, <a href="https://github.com/common-workflow-language/pypi2cwl">pypi2cwl</a>, <a href="https://github.com/common-workflow-language/cwl2argparse">cwl2argparse</a>) on the basis of the feedback from all the participants. We explored the question of pip installability, filed a bunch of <a href="https://github.com/common-workflow-language/gxargparse/issues?utf8=%E2%9C%93&amp;q=%20is%3Aissue%20">issues</a>, tried applying argparse2tool to <a href="https://github.com/dib-lab/khmer">khmer</a> scripts. Another thing we tackled was bug fixes for running <a href="https://github.com/BD2KGenomics/toil">Toil</a> workflow engine on SLURM cluster. In addition, I learned about the inner workings of another important open-source implementation for CWL <a href="https://github.com/rabix/bunny">bunny</a> directly from its creator Janko. During the CWL week, it was added to the community run continuous integration server and successfully <a href="https://twitter.com/commonwl/status/793767714049384448">passed</a> the latest conformance tests.</p> <p>Overall, it was a highly intensive and productive hackathon. I was very happy to meet my mentors and other people from the CWL community in person and to work with them for these few days. I could not imagine a better finish of my Google Summer of Code 2016 participation!</p> <div class="box"> <figure><img src="https://news.open-bio.org/wp-content/uploads/2017/04/london%5Fcwl.jpg" width="978"> </figure> </div> <p>P.S. A year after, I became a mentor on a CWL project myself! Check the idea here: <a href="https://obf.github.io/GSoC/ideas/#cwl-reference-implementation-cwltool">CWL reference implementation</a>.</p> <p>P.P.S. Special thanks to <a href="https://www.open-bio.org/">Open Bioinformatics Foundation</a> for awarding me with the travel fellowship and reimbursing with that a significant part of my travel expenses.</p> <p><em>(Above post contributed by Anton Khodak, <a href="https://anton-khodak.github.io/argparse2cwl-blog/2017/03/17/cwl-hackathon.html">originally on his blog</a>, with our introduction added.)</em></p>https://www.open-bio.org/2016/08/26/biopython-1-68-released/Fri, 26 Aug 2016 16:23:42 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2016/08/26/biopython-1-68-released/<p>Dear Biopythoneers,</p> <p>Source distributions and Windows installers for Biopython 1.68 are now available from the <a href="http://biopython.org/wiki/Download">downloads page</a> on the official <a href="http://biopython.org/">Biopython website</a>, and the release is also <a href="https://pypi.python.org/pypi/biopython/1.68">on the Python Package Index (PyPI)</a>.</p> <p>This release of Biopython supports Python 2.6, 2.7, 3.3, 3.4 and 3.5, but <strong>this will be our final release to run on Python 2.6.</strong> It has also been tested on PyPy 5.0, PyPy3 version 2.4, and Jython 2.7.</p> <p>Bio.PDB has been extended to parse the RSSB&rsquo;s new binary Macromolecular Transmission Format (MMTF, see <a href="http://mmtf.rcsb.org">http://mmtf.rcsb.org</a>), in addition to the mmCIF and PDB file formats (contributed by Anthony Bradley). This requires an optional external dependency on the <a href="https://github.com/rcsb/mmtf-python">mmtf-python library</a>.</p> <p>Module Bio.pairwise2 has been re-written (contributed by Markus Piotrowski). It is now faster, addresses some problems with local alignments, and also now allows gap insertions after deletions, and vice versa, inspired by the <a href="http://dx.doi.org/10.1101/031500">preprint from Flouri et al</a>.</p> <p>The two sample graphical tools SeqGui (Sequence Graphical User Interface) and xbbtools were rewritten (SeqGui) or updated (xbbtools) using the tkinter library (contributed by Markus Piotrowski). SeqGui allows simple nucleotide transcription, back-transcription and translation into amino acids using Bio.Seq internally, offering of the NCBI genetic codes supported in Biopython. xbbtools is able to open Fasta formatted files, does simple nucleotide operations and translations in any reading frame using one of the NCBI genetic codes. In addition, it supports standalone Blast installations to do local Blast searches.</p> <p>New <a href="https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi">NCBI genetic code table</a> 26 (Pachysolen tannophilus Nuclear Code) has been added to Bio.Data (and the translation functionality), and table 11 is now also available under the alias Archaeal.</p> <p>In line with <a href="https://www.ncbi.nlm.nih.gov/news/06-10-2016-ncbi-https/">NCBI website HTTPS changes</a>, Biopython now uses HTTPS rather than HTTP to connect to the NCBI Entrez and QBLAST API.</p> <p>Additionally, a number of small bugs have been fixed with further additions to the test suite, and there has been further work to follow the Python PEP8 and best practice standard coding style.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Anthony Bradley (first contribution)</li> <li>Ben Fulton</li> <li>Carlos Pena</li> <li>Connor T. Skennerton</li> <li>Iddo Friedberg</li> <li>Kai Blin</li> <li>Kristian Davidsen (first contribution)</li> <li>Markus Piotrowski</li> <li>Olivier Morelle (first contribution)</li> <li>Peter Cock</li> <li>Tiago Antao</li> <li>Travis Wrightsman</li> <li>Uwe Schmitt (first contribution)</li> <li>Xiaoyu Zhuo (first contribution)</li> </ul> <p>Thank you all.</p> <p>P.S. You can follow <a href="https://twitter.com/Biopython">@Biopython on Twitter</a></p> <p>Checksums:</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>$ md5sum biopython-1.68.* </span></span><span style="display:flex;"><span>078e915185485a5327937029b7577ddc biopython-1.68.tar.gz </span></span><span style="display:flex;"><span>362e964543a424a2f7585ea4008ea834 biopython-1.68.win32-py2.6.exe </span></span><span style="display:flex;"><span>772d07d9a6490d674688d00ede2bdfe9 biopython-1.68.win32-py2.7.exe </span></span><span style="display:flex;"><span>fda2d1c8d4a7862f6af85122c86fcd0f biopython-1.68.win32-py2.7.msi </span></span><span style="display:flex;"><span>8de95a90704f15f4c22d5359dbc54b75 biopython-1.68.win32-py3.3.exe </span></span><span style="display:flex;"><span>92f40105761520daeeb9128254a8bc94 biopython-1.68.win32-py3.3.msi </span></span><span style="display:flex;"><span>b1cd3f6b4ad1096347d5019c68128dac biopython-1.68.win32-py3.4.exe </span></span><span style="display:flex;"><span>9403b9b0d01c22b49edb34e2164c31de biopython-1.68.win32-py3.4.msi </span></span><span style="display:flex;"><span>72202792fc387376c07e28997ece181f biopython-1.68.win32-py3.5.exe </span></span><span style="display:flex;"><span>ff0cfc6c835ddf890b69ba872fb46b39 biopython-1.68.win32-py3.5.msi </span></span><span style="display:flex;"><span>adb3e8ce60b02b3b46330bbca68f9732 biopython-1.68.zip </span></span></code></pre></div><div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>$ shasum -a 256 biopython-1.68.* </span></span><span style="display:flex;"><span>d1dc09d1ddc8e90833f507cf09f80fa9ee1537d319058d1c44fe9c09be3d0c1f biopython-1.68.tar.gz </span></span><span style="display:flex;"><span>09449d7204c65e6010545092f2bc1dc662a0b5f6a873e52a08e19392f935fdb7 biopython-1.68.win32-py2.6.exe </span></span><span style="display:flex;"><span>a7c2fe52ce8dcf503a492e4ee006dd8bc62faa77078d04c92abdbf7713bf2166 biopython-1.68.win32-py2.7.exe </span></span><span style="display:flex;"><span>f92dfefc9a4ee61dda838a61d73a38b55552a1771ce411505009a48702aefd41 biopython-1.68.win32-py2.7.msi </span></span><span style="display:flex;"><span>bce6a4cece7b75650d6a478f4ed9d7d1a5351df42a1820866a0cbd74c254565d biopython-1.68.win32-py3.3.exe </span></span><span style="display:flex;"><span>85bd5d499400e594f77d297966f56c139499711513b9cd24b87fece5a0463fbe biopython-1.68.win32-py3.3.msi </span></span><span style="display:flex;"><span>05c1f59933ef35ecb838649f6fabacb823f2a48c2498ed57ac59a6b3629b5369 biopython-1.68.win32-py3.4.exe </span></span><span style="display:flex;"><span>10928347029bc6b0b76567d5f6026a8a002bd3502a7ceeaded7d566938db4bef biopython-1.68.win32-py3.4.msi </span></span><span style="display:flex;"><span>5d08e4de11f920ec5207e10d264fceb837e2000843a56fd684e0ee2dfb948fe5 biopython-1.68.win32-py3.5.exe </span></span><span style="display:flex;"><span>299888c32b36f32542775952e7b863bd9c3d362f61a69b7d8a136a63aeabec36 biopython-1.68.win32-py3.5.msi </span></span><span style="display:flex;"><span>986a0fa6919d2b51959259011dd0674b115383237e109c5a55c37cb18eef999b biopython-1.68.zip </span></span></code></pre></div><p><em>Updated</em> 29 August 2016 to include the Python 3.5 installer checksums.</p>https://www.open-bio.org/2016/06/14/new-biojava-logo-design-competition-andreas/Tue, 14 Jun 2016 17:47:52 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2016/06/14/new-biojava-logo-design-competition-andreas/<p><a href="https://github.com/biojava/logo">BioJava</a> is organizing a <strong>design competition</strong> to come up with a new logo. Anybody can participate:</p> <ul> <li> <p>The logo should look modern and be better than the current one (yellow circle)</p> </li> <li> <p>The logo should be able to be rendered as a favicon, as well as large (e.g. on a t-shirt). Designs that come in two (or multiple) sizes are ok.</p> </li> <li> <p>Logos shall not look similar in any way to the trademarked Java programming language logo. This means no coffee cups in any way.</p> </li> </ul> <p><strong>Deadline:</strong> Deadline for submissions is July 4th.</p> <p><strong>Announcement of Winner:</strong> The winner of the new logo competition will be announced during BOSC 2016.</p> <p><strong>Prize:</strong> We will print t-shirts with the new logo and the designer will get a free t-shirt.</p> <p>If the designer of the winning new logo will be attending ISMB 2016, the attending BioJava developers will take the winner out for dinner.</p> <p>BioJava will carry the new logo on its homepage and GitHub Profile</p> <p><strong>Details:</strong> For full details of the competition and how to make a submission please view here:</p> <p><a href="https://github.com/biojava/logo">https://github.com/biojava/logo</a> <strong>Result Update:</strong></p> <p>As <a href="http://mailman.open-bio.org/pipermail/biojava-l/2016-July/011488.html">announced via the mailing list</a> and at BOSC 2016, the winning logo was by Aleix Latifa:</p> <p><img src="https://raw.githubusercontent.com/biojava/logo/master/submissions/lafita_4/logo.png" alt=""></p>https://www.open-bio.org/2016/06/08/biopython-1-67-released/Wed, 08 Jun 2016 17:39:28 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2016/06/08/biopython-1-67-released/<p>This was long over-due, but Biopython 1.67 was released earlier today. The most recent delay was due to migrating our website from MediaWiki to GitHub Pages earlier this year, following an OBF server failure.</p> <p>Source distributions and Windows installers for Biopython 1.67 are now available from the <a href="http://biopython.org/wiki/Download">downloads page</a> on the <a href="http://biopython.org/">official Biopython website</a>, and the release is also on the <a href="https://pypi.python.org/pypi/biopython/1.67">Python Package Index (PyPI)</a>.</p> <p>This release of Biopython supports Python 2.6, 2.7, 3.3, 3.4 and 3.5, but support for Python 2.6 is considered to be deprecated. It has also been tested on PyPy 5.0, PyPy3 version 2.4, and Jython 2.7.</p> <p>Comparison of SeqRecord objects until now has used the default Python object comparison (are they the same instance in memory?). This can be surprising, but comparing all of the attributes would be too complex. As of this release attempting to compare SeqRecord objects should raise an exception instead. If you want the old behaviour, use id(record1) == id(record2) instead.</p> <p>New experimental module Bio.phenotype is for working with Phenotype Microarray plates in JSON and the machine vendor&rsquo;s CSV format (contributed by Marco Galardini).</p> <p>Following the convention used elsewhere in Biopython, there is a new function Bio.KEGG.read(&hellip;) for parsing KEGG files expected to contain a single record only - the existing function Bio.KEGG.parse(&hellip;) is intended to be used to iterate over multi-record files.</p> <p>When a gap character is defined, Bio.Seq will now translate gap codons (e.g. &ldquo;&mdash;&rdquo;) into a single gap (&quot;-&quot;) in the protein sequence. The gap character is inferred from the Seq object&rsquo;s alphabet, but it can also be passed as an argument to the translate method.</p> <p>The new NCBI genetic code table 25, covering Candidate Division SR1 and Gracilibacteria, has been added to Bio.Data (and the translation functionality).</p> <p>The Bio.Entrez interface will automatically use an HTTP POST rather than HTTP GET if the URL would exceed 1000 characters. This is based on NCBI guidelines and the fact that very long queries like complex searches can otherwise trigger an HTTP Error 414 Request URI too long.</p> <p>Foreign keys are now used when creating BioSQL databases with SQLite3 (this was not possible until SQLite version 3.6.19). The BioSQL taxonomy code now updates the taxon table left/right keys when updating the taxonomy.</p> <p>There have been some fixes to the MMCIF structure parser which now uses identifiers which better match results from the PDB structure parse.</p> <p>The restriction enzyme list in Bio.Restriction has been updated to the May 2016 release of REBASE.</p> <p>The mmCIF parser in Bio.PDB.MMCIFParser has been joined by a second version which only looks at the ATOM and HETATM lines and can be much faster.</p> <p>The Bio.KEGG.REST will now return unicode text-based handles, except for images which remain as binary bytes-based handles, making it easier to use with the mostly text-based parsers in Biopython.</p> <p>Note that the BioSQL test configuration information is now in a new file Tests/biosql.ini rather than directly in Tests/test_BioSQL_*.py as before. You can make a copy of the provided example file Tests/biosql.ini.sample as Tests/biosql.ini and edit this if you wish to run the BioSQL tests.</p> <p>Additionally, a number of small bugs have been fixed with further additions to the test suite, and there has been further work to follow the Python PEP8 standard coding style, and in converting our docstring documentation to use the reStructuredText markup style.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Aaron Rosenfeld (first contribution)</li> <li>Anders Pitman (first contribution)</li> <li>Barbara Mühlemann (first contribution)</li> <li>Ben Fulton</li> <li>Ben Woodcroft (first contribution)</li> <li>Brandon Invergo</li> <li>Brian Osborne (first contribution)</li> <li>Carlos Pena</li> <li>Chaitanya Gupta (first contribution)</li> <li>Chris Warth (first contribution)</li> <li>Christiam Camacho (first contribution)</li> <li>Connor T. Skennerton</li> <li>David Koppstein (first contribution)</li> <li>Eric Talevich</li> <li>Jacek Śmietański (first contribution)</li> <li>João D Ferreira (first contribution)</li> <li>João Rodrigues</li> <li>Joe Cora (first contribution)</li> <li>Kai Blin</li> <li>Leighton Pritchard</li> <li>Lenna Peterson</li> <li>Marco Galardini (first contribution)</li> <li>Markus Piotrowski</li> <li>Matt Ruffalo (first contribution)</li> <li>Matteo Sticco (first contribution)</li> <li>Nader Morshed (first contribution)</li> <li>Owen Solberg (first contribution)</li> <li>Peter Cock</li> <li>Steve Bond (first contribution)</li> <li>Terry Jones (first contribution)</li> <li>Vincent Davis</li> <li>Zheng Ruan</li> </ul> <p>Again this list of contributors is longer than usual, which is good, but partly reflects the delay since our last release. My apologies.</p>https://www.open-bio.org/2016/05/23/first-obf-travel-fellowships/Mon, 23 May 2016 16:05:25 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2016/05/23/first-obf-travel-fellowships/<p>The first round of the <a href="https://github.com/OBF/obf-docs/blob/master/Travel_fellowships.md">Open Bioinformatics Foundation travel fellowship program</a> has granted funds to three open source bioinformatics software developers to help them attend the <a href="https://www.open-bio.org/wiki/BOSC_2016">Bioinformatics Open Source Conference (BOSC) 2016</a> in Orlando, Florida, this July. The travel fellowship program ( <a href="https://news.open-bio.org/2016/03/01/obf-travel-fellowship-program/">announced 1 May 2016</a>) aims to increase diverse participation at events promoting open source bioinformatics software development and open science in the biological research community. Applications for the first round in 2016 were due on April 15, with two more due dates this year on August 15 and December 15.</p> <p>Out of more than a dozen applicants from four different continents, the OBF Board chose the following three recipients:</p> <ul> <li><a href="https://github.com/dimitras">Dimitra Sarantopoulou</a> of the University of Pennsylvania is an open source bioinformatics developer who focuses on web applications for proteomic analysis.</li> <li>Michael R. Crusoe ( <a href="https://twitter.com/biocrusoe">@biocrusoe</a>) is the Co-founder &amp; Community Engineer for the <a href="http://www.commonwl.org/">Common Workflow Language (CWL)</a>, and previously was the lead developer of <a href="https://github.com/dib-lab/khmer">khmer</a>.</li> <li><a href="http://wurmlab.github.io/team/priyam/">Anurag Priyam</a> is a self-taught bioinformaticst who has created several successful open source tools, including  <a href="https://github.com/wurmlab/sequenceserver">SequenceServer</a> and <a href="https://github.com/wurmlab/oswitch">oswitch</a>, a Docker-based virtual environment switcher.</li> </ul> <p>The OBF Board congratulates the three winners!</p> <p>This first round has also shown several points of improvement, both for the program description and the application form. We are in the process of making small adjustments to both, and expect to reopen the application form for the next round of funding at the latest by the time BOSC 2016 rolls around (July 8). We encourage others for whom travel costs are a barrier to participating in open source bioinformatics events to apply for this next round (due date is August 15, 2016).</p>https://www.open-bio.org/2016/04/25/welcome-gsoc-2016-students/Mon, 25 Apr 2016 08:13:45 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2016/04/25/welcome-gsoc-2016-students/<p>The Open Bioinformatics Foundation is participating in the Google Summer of Code 2016 program, and last Friday the selected students were announced. Congratulations to all of you, and welcome. I also want to use this opportunity to thank all students who applied. Resources are limited and your proposals did not make it easy to select our finalists. We wish you all the best for your future endeavours, and hope to be able to work with you in future. The field of bioinformatics is a small one after all.</p> <p>The Open Bioinformatics Foundation gets to host <a href="https://summerofcode.withgoogle.com/organizations/5693436329984000/#projects">eight student projects this</a> year:</p> <ul> <li><a href="https://github.com/AlishaMechtley/treematcher/wiki/Blog">Alisha Mechtley</a> will work with the ETE toolkit on tree searching using regular-expression-like queries.</li> <li><a href="https://anton-khodak.github.io/argparse2cwl-blog/2016/08/11/gentle-introduction.html">Anton Khodak</a> will work on the Common Workflow Language, creating an automated tool wrapper/converter for CWL.</li> <li><a href="https://chfi.se/posts/2016-08-22-gsoc-final.html">Christian Fischer</a> will work on the GeneNetwork Genome Browser.</li> <li><a href="https://sxibolet.2pitau.org/gsoc.html">Graham Dyer</a> will work on openSNP, extending the quantified-self support.</li> <li><a href="https://github.com/bionode/gsoc16/blob/8a155a14c34d820a3a77d15b3600d4adf225f179/README.md">Julian Mazzitelli</a> will work on a workflow engine for streamed data analysis in Bionode.</li> <li><a href="https://bitbucket.org/mnave/gsoc-blog/">Mariana Nave</a> will improve the prediction for RiPP clusters in antiSMASH.</li> <li><a href="http://mateusjabour.github.io/gsoc-code-submission">Mateus Jabor</a> will work on improving the user experience in openSNP.</li> <li><a href="http://raivivek.in/programming/gsoc-16-wrap-up.html#main">Vivek Rai</a> will work on linking phenotypes to SNPs in openSNP.</li> </ul> <p>Please join me in welcoming all of them in the Open Bioinformatics Foundation community and the respective subprojects. It looks like this will be a great summer.</p> <p>Kai Blin</p> <p>OBF administrator for GSoC 2016</p> <p><em>P.S. We have retrospectively updated this post to add links to the students&rsquo; blog posts.</em></p>https://www.open-bio.org/2016/03/28/bosc-codefest-2016/Mon, 28 Mar 2016 13:56:07 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2016/03/28/bosc-codefest-2016/<p>The <a href="https://www.open-bio.org/wiki/BOSC_2016">Bioinformatics Open Source Conference (BOSC)</a> is a two day meeting focused on open source bioinformatics. We aim to encourage and support a friendly, open and productive community that helps us work together to answer hard biological questions. We&rsquo;ll get together this summer, July 8-9, in Orlando, Florida.</p> <p>Abstracts for BOSC 2016 talks and posters are due this Friday, April 1st. We want to hear about your research and encourage everyone to <a href="https://www.open-bio.org/wiki/BOSC_Abstract_Submission">submit an abstract</a>. We love talks from newcomers to BOSC as well as established projects: no idea is too big or small. We also offer <a href="https://www.open-bio.org/2016/03/01/obf-travel-fellowship-program/">Travel Fellowships for speakers</a> if money would be a barrier to attending.</p> <p>Prior to BOSC, we organize a free two day collaborative working session called <a href="https://www.open-bio.org/wiki/Codefest_2016">Codefest</a>. We&rsquo;ll establish friendships and collaborations while helping new members find fun work and extending existing projects. It&rsquo;s a time to learn, teach, develop and grow. This year we&rsquo;re kindly hosted by the <a href="https://familab.org/">FamiLAB workspace</a> in Orlando. So in addition to getting to work with fellow OpenBio members, you&rsquo;ll have the chance to learn about the Orlando maker community.</p> <p>We hope you&rsquo;ll join us in Orlando this summer for Codefest and BOSC. Please send in your abstracts before Friday and sign up on the Codefest page.</p>https://www.open-bio.org/2016/03/22/bosc-2016-keynote-speakers/Tue, 22 Mar 2016 12:10:51 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2016/03/22/bosc-2016-keynote-speakers/<p>We&rsquo;re delighted to announce the keynote speakers for the <a href="https://www.open-bio.org/wiki/BOSC_2016">Bioinformatics Open Source Conference, BOSC 2016</a>:</p> <h1 id="jennifer-gardy">Jennifer Gardy</h1> <p><a href="https://www.open-bio.org/wiki/File:JenniferGardy.jpg" title="Jennifer Gardy"><img src="https://www.open-bio.org/w/images/thumb/0/04/JenniferGardy.jpg/240px-JenniferGardy.jpg" alt="Jennifer Gardy"></a></p> <p>Dr. Jennifer Gardy is both a scientist and science communicator. She holds a PhD in Bioinformatics, and is an Assistant Professor of Population and Public Health at the University of British Columbia and a Senior Scientist at the British Columbia Centre for Disease Control (BCCDC). At the BCCDC, she pioneered a new way of investigating outbreaks of infectious diseases – &ldquo;genomic epidemiology&rdquo;, which uses a pathogen&rsquo;s genome sequence as a tool for understanding how an infectious disease spreads. Her group was the first to use genome sequencing to reconstruct a large outbreak of tuberculosis, and she is continuing to apply this novel technique to other outbreak scenarios. She is also involved in other genomics-related research, including replacing traditional laboratory microbiology protocols with single genomic analyses. In 2014, she was appointed the Canada Research Chair in Public Health Genomics, and is Senior Editor at the new open data, open access journal Microbial Genomics.</p> <p>In addition to her career as a research scientist, Dr. Gardy is known for her work in science communication and education, both in print and on TV. She has made regular appearances on CBC&rsquo;s documentary series The Nature of Things, has hosted CBC&rsquo;s eight-part science series Project X, and is a regular guest host on Discovery Channel’s Daily Planet science show. She has written and blogged for the Globe and Mail, has written a children’s book – It’s Catching! The Infectious World of Germs and Microbes – and runs a series of workshops on how to communicate science effectively.</p> <p>Dr. Gardy&rsquo;s keynote topic is “The open-source outbreak: can data prevent the next pandemic?”</p> <p><em>Every century, something comes along that shakes up public health – vaccines, sanitation, antibiotics – and data promises to be the great disrupter of 21st century infectious disease epidemiology. In the last 5-6 years, genomics has dramatically changed how public health agencies diagnose and investigate diseases from food poisoning to tuberculosis, giving us a new tool to understand and control infections. The change is also apparent at a cultural level – genomics and bioinformatics researchers have largely come from an open data, collaborative space and have brought new ways of thinking to public health laboratories, previously secret, closed organizations. In this talk, we’ll explore some of the dramatic changes in public health microbiology that genomics and bioinformatics has facilitated, and look at how future data sharing efforts in areas such as digital disease detection might be the key to preventing future pandemics.</em></p> <p>Homepage: <a href="http://www.jennifergardy.com">Jennifer Gardy</a>, Twitter: <a href="https://twitter.com/jennifergardy">@JenniferGardy</a></p> <hr> <h1 id="steven-salzberg">Steven Salzberg</h1> <p><a href="https://www.open-bio.org/wiki/File:StevenSalzberg.jpg" title="Steven Salzberg"><img src="https://www.open-bio.org/w/images/thumb/3/3b/StevenSalzberg.jpg/210px-StevenSalzberg.jpg" alt="Steven Salzberg"></a></p> <p>Dr. Steven Salzberg is the Bloomberg Distinguished Professor of Biomedical Engineering, Computer Science, and Biostatistics and the Director of the Center for Computational Biology in the McKusick-Nathans Institute of Genetic Medicine at Johns Hopkins University. From 2005-2011, he was the Director of the Center for Bioinformatics and Computational Biology and the Horvitz Professor of Computer Science at the University of Maryland, College Park. From 1997-2005 he was Senior Director of Bioinformatics at The Institute for Genomic Research (TIGR) in Rockville, Maryland, one of the world&rsquo;s leading DNA sequencing centers at the time.</p> <p>Salzberg&rsquo;s lab currently focuses on next-generation sequence alignment, genome assembly, and microbiome analysis.They have produced several popular systems for alignment of next-generation sequencing reads, including the Bowtie, Tophat, and Cufflinks systems. All of the group&rsquo;s software is free and open source, and their systems have been downloaded hundreds of thousands of times.</p> <p>Dr. Salzberg is a Fellow of the American Association for the Advancement of Science (AAAS) and a Fellow of the International Society for Computational Biology (ISCB). He was the 2013 winner of the Benjamin Franklin Award for Open Access in the Life Sciences, in recognition of his many contributions to open access bioinformatics software and his strong advocacy for open access to data, software and publications.</p> <p>Dr. Salzberg will speak about &ldquo;Open source, open access, and open data: why science moves faster in an open world&rdquo;.</p> <p><em>The Human Genome Project established a practice of sharing data rapidly, prior to publication, that has since become a model for many projects in genomics. Data sharing has been slow to penetrate other fields because of many factors, some of which I will discuss in this talk. Nevertheless, sharing of methods, data, and results helps science move ahead faster, and openness is essential for the continual process of checking and self-correction that good science requires. I will discuss some of the successes as well as some noteworthy mistakes that have been discovered thanks to open science.</em></p> <p>Homepage: <a href="https://salzberg-lab.org/">Steven Salzberg</a>, Twitter: <a href="https://twitter.com/StevenSalzberg1">@StevenSalzberg1</a></p> <hr> <p>The <a href="https://www.open-bio.org/2016/03/01/bosc-2016-call-for-abstracts/">BOSC 2016 call for abstracts is currently open</a>, and <a href="https://www.iscb.org/ismb2016-registration">BOSC/ISMB 2016 registration</a> will open next week. We hope to see you in Florida!</p>https://www.open-bio.org/2016/03/01/bosc-2016-call-for-abstracts/Tue, 01 Mar 2016 17:42:48 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2016/03/01/bosc-2016-call-for-abstracts/<p>Call for Abstracts for the 17th Annual Bioinformatics Open Source Conference (BOSC 2016), a Special Interest Group (SIG) of <a href="https://www.iscb.org/ismb2016">ISMB 2016</a>.</p> <p><a href="https://www.open-bio.org/wiki/BOSC_2016"><img src="https://www.open-bio.org/w/images/b/b0/Pear.png" alt="[BOSC Logo]"></a></p> <ul> <li>Dates: July 8-9, 2016</li> <li>Location: Orlando, FL</li> <li>Web site: <a href="https://www.open-bio.org/wiki/BOSC_2016">/wiki/BOSC_2016</a></li> <li>Email: <a href="mailto:bosc@open-bio.org">bosc@open-bio.org</a></li> <li>BOSC announcements mailing list: <a href="http://lists.open-bio.org/mailman/listinfo/bosc-announce">http://lists.open-bio.org/mailman/listinfo/bosc-announce</a></li> <li>Twitter: <a href="https://twitter.com/OBF_BOSC" title="OBF Bioinformatics Open Source Conference (BOSC)">@OBF_BOSC</a> and <a href="https://twitter.com/OBF_news" title="Open Bioinformatics Foundation (OBF) News">@OBF_News</a></li> </ul> <p>Important Dates:</p> <p><a href="http://www.iscb.org/ismb2016"><img src="https://news.obf.io/wp-content/uploads/2016/03/ismb2016.png" alt="[ISMB 2016 logo]"></a></p> <ul> <li>Call for one-page abstracts opens: March 1, 2016</li> <li><a href="https://www.open-bio.org/wiki/BOSC_Abstract_Submission">Abstract submission</a> deadline: April 1, 2016 - <em>extended to Monday 4 April 2016</em></li> <li>Travel fellowship application deadline: April 15, 2016</li> <li>Authors notified: May 6, 2016</li> <li><a href="https://www.open-bio.org/wiki/Codefest_2016">Codefest 2016</a>: July 6-7, 2016, Orlando, FL (confirming venue)</li> <li><a href="https://www.open-bio.org/wiki/BOSC_2016">BOSC 2016</a>: July 8-9, 2016, Orlando, FL</li> <li><a href="https://www.iscb.org/ismb2016">ISMB 2016</a>: July 8-12, 2016, Orlando, FL</li> </ul> <p>The Bioinformatics Open Source Conference (BOSC) is run as a two-day meeting before the annual ISMB conference. It is organized by the Open Bioinformatics Foundation (OBF), a non-profit group dedicated to promoting the practice and philosophy of open source software development and open science within the biological research community. BOSC offers a focused environment for developers and users to interact and share ideas about standards; software development practices; practical techniques for solving bioinformatics problems; and approaches that promote open science and sharing of data, results and software.</p> <p>We welcome one-page abstracts on any topic of relevance to open source bioinformatics and open science. Presentation formats are lightning talks, longer talks, and/or posters. We plan to offer a limited number of travel fellowships to help offset expenses for some accepted speakers who would not otherwise be able to attend BOSC – please see the <a href="https://www.open-bio.org/2016/03/01/obf-travel-fellowship-program/">OBF Travel Fellowship announcement</a> for more information.</p> <p>Session topics include:</p> <ul> <li>Open Science and Reproducible Research</li> <li>Standards and Interoperability</li> <li>Data Science</li> <li>Visualization</li> <li>Translational Bioinformatics</li> <li>Bioinformatics Open Source Libraries and Projects</li> </ul> <p>If your company or organization is interested in helping to sponsor BOSC 2016, please contact us! Sponsors in 2015 included <a href="http://www.google.com/">Google</a>, <a href="http://www.gigasciencejournal.com/">GigaScience</a>, <a href="http://curoverse.com/">Curoverse</a> and <a href="http://bina.com/">Bina</a> – we thank them for their support.</p> <p>BOSC 2016 Organizing Committee: Nomi Harris and Peter Cock (co-chairs), Brad Chapman, Christopher Fields, Karsten Hokamp, Hilmar Lapp, Mónica Muñoz-Torres, Heather Wiencko</p>https://www.open-bio.org/2015/10/21/biopython-1-66-released/Wed, 21 Oct 2015 19:55:16 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2015/10/21/biopython-1-66-released/<p>Source distributions and Windows installers for Biopython 1.66 are now available from the <a href="http://biopython.org/wiki/Download">downloads page</a> on the <a href="http://biopython.org/">official Biopython website</a> and from the <a href="https://pypi.python.org/pypi/biopython/1.66">Python Package Index (PyPI)</a>.</p> <p>This release of Biopython supports Python 2.6, 2.7, 3.3, 3.4 and 3.5, although support for Python 2.6 is now deprecated. It has also been tested on PyPy 2.4 to 2.6, PyPy3 version 2.4, and Jython 2.7.</p> <p>Further work on the <code>Bio.KEGG</code> and <code>Bio.Graphics</code> modules now allows drawing KGML pathways with transparency.</p> <p>The <code>Bio.SeqIO &quot;abi&quot;</code> parser now decodes almost all the documented fields used by the ABIF instruments - including the individual color channels.</p> <p><code>Bio.PDB</code> now has a <code>QCPSuperimposer</code> module using the Quaternion Characteristic Polynomial algorithm for superimposing structures. This is a fast alternative to the existing <code>SVDSuperimposer</code> code using singular value decomposition.</p> <p>Bio.Entrez now implements the NCBI Entrez Citation Matching function (ECitMatch), which retrieves PubMed IDs (PMIDs) that correspond to a set of input citation strings. <code>Bio.Entrez.parse(...)</code> now supports NCBI XML files using XSD schemas, which will be downloaded and cached like NCBI DTD files.</p> <p>A subtle bug in how multi-part GenBank/EMBL locations on the reverse strand were parsed into CompoundLocations was fixed: <code>complement(join(...))</code> as used by NCBI worked, but <code>join(complement(...),complement(...),...)</code> as used by EMBL/ENSEMBL gave the CompoundLocation parts in the wrong order. A related bug when taking the reverse complement of a SeqRecord containing features with CompoundLocations was also fixed.</p> <p>Additionally, a number of small bugs have been fixed with further additions to the test suite, and there has been further work on conforming to the Python PEP8 standard coding style.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Alan Medlar (first contribution)</li> <li>Anthony Mathelier (first contribution)</li> <li>Antony Lee (first contribution)</li> <li>Anuj Sharma (first contribution)</li> <li>Ben Fulton (first contribution)</li> <li>Bertrand Néron (first contribution)</li> <li>Brandon Invergo</li> <li>Carlos Pena</li> <li>Christian Brueffer</li> <li>Connor T. Skennerton (first contribution)</li> <li>David Arenillas (first contribution)</li> <li>David Nicholson (first contribution)</li> <li>Emmanuel Noutahi (first contribution)</li> <li>Eric Rasche (first contribution)</li> <li>Fabio Madeira (first contribution)</li> <li>Franco Caramia (first contribution)</li> <li>Gert Hulselmans (first contribution)</li> <li>Gleb Kuznetsov (first contribution)</li> <li>João Rodrigues</li> <li>John Bradley (first contribution)</li> <li>Kai Blin</li> <li>Kian Ho (first contribution)</li> <li>Kozo Nishida (first contribution)</li> <li>Kuan-Yi Li (first contribution)</li> <li>Leighton Pritchard</li> <li>Lucas Sinclair</li> <li>Michiel de Hoon</li> <li>Peter Cock</li> <li>Saket Choudhary</li> <li>Sunhwan Jo (first contribution)</li> <li>Tarcisio Fedrizzi (first contribution)</li> <li>Tiago Antao</li> <li>Vincent Davis</li> </ul> <p>This is a longer list than usual, which is good, but in part this reflects the fact that this release is long overdue. Sorry, that was my fault.</p>https://www.open-bio.org/2015/06/05/bosc-2015-panel-increasing-diversity/Fri, 05 Jun 2015 10:29:46 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2015/06/05/bosc-2015-panel-increasing-diversity/<p>Every year, BOSC includes a panel discussion that offers all attendees the chance to engage in conversation with the panelists and each other. Two months ago <a href="http://news.open-bio.org/news/2015/04/bosc-2014-diversity/">we announced the theme</a> of the BOSC 2015 panel would be &quot; <em>Open Source, Open Door: increasing diversity in the bioinformatics open source community&quot;</em>. Our complete list of panellists is:</p> <ul> <li>Panel chair <strong>Mónica Muñoz-Torres</strong> ( <a href="https://twitter.com/monimunozto">@monimunozto</a>) is the lead biocurator at Berkeley Bioinformatics Open-Source Projects (BBOP). She is part of the development teams for Web Apollo (a web-based annotation editor designed to support community-based curation of genomes) and the tools of the Gene Ontology (GO) Consortium. She co-leads the Community Curation group within the global initiative to sequence and annotate the genomes of 5,000 arthropods (i5K Initiative), and is a member of the Executive Committee of the International Society for Biocuration (ISB). As a graduate student, Monica founded the first Southeastern Chapter of the Society for Advancement of Hispanics/Chicanos and Native Americans in Science (SACNAS) at Clemson University; the chapter has since been actively involved in outreach activities to local high schools in an attempt to inspire students to pursue careers in STEM. She is currently working on forming the first professional chapter of SACNAS in the San Francisco Bay area.</li> <li><strong>Holly Bik</strong> ( <a href="https://twitter.com/hollybik">@hollybik</a>) is a Birmingham Fellow (assistant professor) in the School of Biosciences at the University of Birmingham, UK. Her research uses high-throughput environmental sequencing approaches (rRNA surveys, metagenomics) to explore biodiversity and biogeographic patterns in microbial eukaryote assemblages, with an emphasis on nematodes in marine sediments. Through active collaborations with computer scientists and participation in software development projects, her long-term research aims to address existing bottlenecks encountered in –Omic analyses focused on microbial eukaryotes.</li> <li><strong>Michael R. Crusoe</strong> ( <a href="https://twitter.com/biocrusoe">@biocrusoe</a>) is the lead for the k-h-mer project at C. Titus Brown&rsquo;s Lab for Data Intensive Biology at the University of California, Davis in the School of Veterinary Medicine. A community-minded bioinformatics research software engineer and Software Carpentry instructor, he is also a member of the Debian Med software packaging team. Michael&rsquo;s social justice background includes a prior seat on the board for the Phoenix, Arizona chapter of GLSEN, the Gay, Lesbian, and Straight Education Network and he is proud to be a supporter of the Ada Initiative.</li> <li><strong>Aleksandra Pawlik</strong> ( <a href="https://twitter.com/aleksandrana">@aleksandrana</a>) is a Training Lead at the Software Sustainability Institute at Manchester University, UK. She coordinates training activities and helps develop strategies and curricula for teaching computational lab skills to researchers across disciplines at all stages of their research career. She is a member of the Steering Committees for Data Carpentry and Software Carpentry Foundation, and supports the development of both initiatives. Currently, Aleksandra is collaborating on training with the ELIXIR project supporting the bioinformatics community. As a certified Software and Data Carpentry instructor Aleksandra has taught at a number of workshops, including Software Carpentry for Women in Science and Engineering, which she co-organised.</li> <li><strong>Jason Williams</strong> ( <a href="https://twitter.com/JasonWilliamsNY">@JasonWilliamsNY</a>) is the Lead of the iPlant Collaborative’s Education, Outreach, Training (EOT) group, based at Cold Spring Harbor Laboratory, where he has worked for over 10 years. He is also a Lead Instructor of “The Science Institute” at Yeshiva University High School for Girls, and the Treasurer of the Software Carpentry Foundation. His background is in molecular biology and bioinformatics. Diversity is a focus of Jason&rsquo;s work at the DNA Learning Center and with iPlant, where he works to target outreach along the entire spectrum of underrepresented and underserved groups ranging from minorities in urban communities to first-generation college students at rural institutions.</li> </ul> <p>In addition the BOSC 2015 co-chairs <strong>Nomi Harris</strong> and <strong>Peter Cock</strong> will be on hand, along with other Open Bioinformatics Foundation (OBF) Board Members and BOSC organising committee members, to comment on what BOSC and the OBF are trying to do to improve diversity in the open source bioinformatics community, and listen to suggestions.</p> <p>P.S. Today is the deadline for discounted early <a href="https://www.iscb.org/ismbeccb2015-registration#registrationfee" title="ISMB/ECCB 2015 registration, including BOSC">registration</a>, and the deadline to submit a late breaking lightning talk or poster abstract. See <a href="https://www.open-bio.org/wiki/BOSC_2015">BOSC 2015</a> for more details.</p>https://www.open-bio.org/2015/04/02/bosc-2014-diversity/Thu, 02 Apr 2015 22:09:39 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2015/04/02/bosc-2014-diversity/<p>The <a href="https://www.open-bio.org/wiki/BOSC_2015">Bioinformatics Open Source Conference (BOSC)</a> has always been about community. Launched in 2000, BOSC aims to provide a forum for both bioinformatics developers and users to share ideas and code and learn about the latest developments in open source bioinformatics and open science.</p> <p>Our goal this year is to welcome even greater participation, opening the door even wider to participants who have historically been underrepresented in the world of open source bioinformatics and, therefore, at BOSC. This includes (but is by no means limited to) women, people who aren&rsquo;t white, older people, people from outside North America and Europe, and non-programmers.</p> <p>During a Birds of a Feather (BoF) session held at <a href="https://www.open-bio.org/wiki/BOSC_2014">BOSC 2014</a>, we discussed ways to increase the diversity of BOSC attendees, and gathered many useful suggestions from the participants, some of which we have already acted upon.</p> <p>One of the suggestions from the 2014 BoF was to add someone to the organizing committee to focus on outreach and community-building. In January 2015, <a href="http://news.open-bio.org/news/2015/01/bosc-welcomes-sarah-hird/">we welcomed Dr. Sarah Hird as our new Outreach Coordinator</a>. Sarah is currently a UC Davis Chancellor&rsquo;s Postdoctoral Fellow with Jonathan Eisen in the UC Davis Genome Center, where her research interests lie at the intersection of phylogeography, bioinformatics and microbial diversity. Sarah is also known for her focus on <a href="https://sites.google.com/site/sarahhird/diversity-in-stem">promoting diversity in STEM</a>.  &quot; <em>I am personally and professionally interested in how we can make “the Academy&quot; a more representative sample of the world around us,</em>&quot; she says.</p> <p>During the 2014 BoF, we were asked whether BOSC planned to adopt a Code of Conduct. We felt that this should be an ISCB-wide effort, not one that is limited to a single SIG. Our advocacy efforts with the ISCB were successful with a <a href="https://www.iscb.org/ismbeccb2015-general-info/ismbeccb2015-coc">code of conduct published on the ISMB/ECCB 2015 website</a>. We are very pleased that ISCB joins us in wanting to foster a collegial and productive environment for everyone who attends the conferences. The code of conduct will also be announced in the ISCB April Newsletter.</p> <p>The high price of travel and registration can make it hard for some people to attend BOSC. We are trying to lower this barrier by offering free or half-price registration to a limited number of accepted speakers - please indicate in the Comments section of your abstract submission if you would like to apply for this. We also award Student Travel Fellowships to the authors of the three best student abstracts each year; these provide $250 to offset travel costs, as well as granting free registration to BOSC.</p> <p>Every year, the agenda at BOSC includes a panel that gives all participants the opportunity to engage each other in discussion. This year, our panel discussion will focus on increasing diversity in our community and at our conferences. The panel will be chaired by <em>Monica Munoz-Torres</em> and will include panellists <em>Holly Bik</em> and <em>Jason Williams</em> (see bios below).</p> <ul> <li> <p>Dr. Monica Munoz-Torres (Twitter: @monimunozto) is the lead biocurator at Berkeley Bioinformatics Open-Source Projects (BBOP). She is part of the development teams for Web Apollo (a web-based annotation editor designed to support community-based curation of genomes) and the tools of the Gene Ontology (GO) Consortium. She co-leads the Community Curation group within the global initiative to sequence and annotate the genomes of 5,000 arthropods (i5K Initiative), and is a member of the Executive Committee of the International Society for Biocuration (ISB).</p> </li> <li> <p>Dr Holly Bik (Twitter: @hollybik) is a Birmingham Fellow (assistant professor) in the School of Biosciences at the University of Birmingham, UK. Her research uses high-throughput environmental sequencing approaches (rRNA surveys, metagenomics) to explore biodiversity and biogeographic patterns in microbial eukaryote assemblages, with an emphasis on nematodes in marine sediments. Through active collaborations with computer scientists and participation in software development projects, her long-term research aims to address existing bottlenecks encountered in –Omic analyses focused on microbial eukaryotes.</p> </li> <li> <p>Jason Williams (Twitter: @JasonWilliamsNY) is the Lead of the iPlant Collaborative&rsquo;s Education, Outreach, Training (EOT) group, based at Cold Spring Harbor Laboratory, where he has worked for over 10 years. He is also a Lead Instructor of &ldquo;The Science Institute&rdquo; at Yeshiva University High School for Girls, and the Treasurer of the Software Carpentry Foundation. His background is in molecular biology and bioinformatics.</p> </li> </ul> <p>We are looking for two more panellists, and have some ideas - but your suggestions are welcome! Please [email the BOSC committee](mailto:bosc@open-bio.org?subject=BOSC 2015 Panelists) or just tweet panellist ideas at @OBF_BOSC.</p> <p><a href="http://termpapersnetwork.com/">term paper writing service</a></p> <p>Finally, please spread the word about BOSC! The deadline for <a href="https://www.open-bio.org/wiki/BOSC_Abstract_Submission">submitting abstracts</a> for regular-length talks is tomorrow (Friday, April 3 <em>- update: extended to Tuesday, April 7 due to Easter/Passover weekend</em>), but there will also be opportunities for last-minute lightning talks and posters.</p>https://www.open-bio.org/2015/03/26/bosc-2015-keynote-speakers/Thu, 26 Mar 2015 16:05:48 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2015/03/26/bosc-2015-keynote-speakers/<p>Announcing the keynote speakers for the <a href="https://www.open-bio.org/wiki/BOSC_2015">Bioinformatics Open Source Conference, BOSC 2015</a>:</p> <h1 id="holly-bik">Holly Bik</h1> <p><a href="https://www.open-bio.org/wiki/File:HollyBik.png" title="Holly Bik"><img src="https://www.open-bio.org/w/images/thumb/3/37/HollyBik.png/180px-HollyBik.png" alt="Holly Bik"></a> Dr Holly Bik is a Birmingham Fellow (assistant professor) in the School of Biosciences at the University of Birmingham, UK. She obtained her Ph.D. in molecular phylogenetics at the University of Southampton, UK (working in conjunction with the Natural History Museum, London), followed by subsequent postdoctoral appointments at the Hubbard Center for Genome Studies at the University of New Hampshire and the UC Davis Genome Center.</p> <p>Her research uses high-throughput environmental sequencing approaches (rRNA surveys, metagenomics) to explore biodiversity and biogeographic patterns in microbial eukaryote assemblages, with an emphasis on nematodes in marine sediments. Through active collaborations with computer scientists and participation in software development projects, her long-term research aims to address existing bottlenecks encountered in –Omic analyses focused on microbial eukaryotes. Holly&rsquo;s keynote talk topic is &ldquo;Bioinformatics: Still a scary world for biologists&rdquo;.</p> <p><em>Many biological disciplines remain staunchly traditional, where high-throughput DNA sequencing and bioinformatics have not yet become widely adopted. In this talk, I&rsquo;ll discuss the ongoing challenges and barriers facing biologists in the age of &lsquo;Omics, based on my experiences in transitioning from nematode taxonomy to computational biology research.</em></p> <p>Homepage: <a href="http://www.hollybik.com/about/">Holly Bik</a>, Twitter: <a href="https://twitter.com/hollybik">@hollybik</a></p> <hr> <h1 id="ewan-birney">Ewan Birney</h1> <p><a href="https://www.open-bio.org/wiki/File:EwanBirney2.jpg" title="Ewan Birney"><img src="https://www.open-bio.org/w/images/thumb/0/08/EwanBirney2.jpg/230px-EwanBirney2.jpg" alt="Ewan Birney"></a> Dr Ewan Birney is Joint Associate Director of EMBL-EBI, as well as Interim Head of the Centre for Therapeutic Target Validation. Together with Dr Rolf Apweiler, he has strategic responsibility and oversight for bioinformatics services at EMBL-EBI.</p> <p>Ewan played a vital role in annotating the genome sequences of the human, mouse, chicken and several other organisms; this work has had a profound impact on our understanding of genomic biology. He led the analysis group for the ENCODE project, which is defining functional elements in the human genome. He was also one of the leaders of the BioPerl project. Ewan’s main areas of research include functional genomics, assembly algorithms, statistical methods to analyse genomic information (in particular information associated with individual differences) and compression of sequence information.</p> <p>He has received a number of prestigious awards including the 2003 Francis Crick Award from the Royal Society, the 2005 Overton Prize from the International Society for Computational Biology and the 2005 Benjamin Franklin Award for contributions in Open Source Bioinformatics. He was elected a Fellow of the Royal Society in 2014.</p> <p>Ewan was a cofounder of the <a href="https://www.open-bio.org/" title="Main Page">Open Bioinformatics Foundation</a>, the organization that sponsors BOSC, and has been involved in BOSC since the first conference in 2000. He chaired the meeting in 2001, and gave one of the keynote talks in 2002. We are delighted to have him back as a keynote speaker for 2015.</p> <p>Ewan&rsquo;s talk topic will be announced soon.</p> <p>Homepage: <a href="https://www.ebi.ac.uk/%7Ebirney/">Ewan Birney</a>, Twitter: <a href="https://twitter.com/ewanbirney">@ewanbirney</a></p> <hr> <p>The <a href="http://news.open-bio.org/news/2015/03/bosc-2015-call-for-abstracts/">BOSC 2015 call for abstracts is currently open</a>, and <a href="https://www.iscb.org/ismbeccb2015-registration">BOSC/ISMB/ECCB 2015 registration</a> has also just opened. We hope to see you in Dublin!</p>https://www.open-bio.org/2015/03/05/bosc-2015-call-for-abstracts/Thu, 05 Mar 2015 21:00:11 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2015/03/05/bosc-2015-call-for-abstracts/<p>Call for Abstracts for the 16th Annual Bioinformatics Open Source Conference (BOSC 2015), a Special Interest Group (SIG) of ISMB/ECCB 2015.</p> <p><a href="https://www.open-bio.org/wiki/BOSC_2015"><img src="https://www.open-bio.org/w/images/b/b0/Pear.png" alt="[BOSC Logo]"></a></p> <ul> <li>Dates: 10-11 July, 2015</li> <li>Location: Dublin, Ireland</li> <li>Web site: <a href="https://www.open-bio.org/wiki/BOSC_2015">/wiki/BOSC_2015</a></li> <li>Email: <a href="mailto:bosc@open-bio.org">bosc@open-bio.org</a></li> <li><a href="http://lists.open-bio.org/mailman/listinfo/bosc-announce">BOSC announcements mailing list</a></li> <li>Twitter: <a href="https://twitter.com/OBF_BOSC" title="OBF Bioinformatics Open Source Conference (BOSC)">@OBF_BOSC</a> and <a href="https://twitter.com/OBF_news" title="Open Bioinformatics Foundation (OBF) News">@OBF_News</a></li> </ul> <p>Important Dates:</p> <p><a href="http://www.iscb.org/ismbeccb2015"><img src="https://news.obf.io/wp-content/uploads/2015/03/ismb_eccb_2015_dublin.png" alt="ismb_eccb_2015"></a></p> <ul> <li>March 24, 2015: Registration opens for ISMB and BOSC ( <a href="https://www.iscb.org/ismbeccb2015-registration">https://www.iscb.org/ismbeccb2015-registration</a>)</li> <li>April 3, 2015: Deadline for <a href="https://www.open-bio.org/wiki/BOSC_Abstract_Submission">submitting BOSC abstracts</a></li> <li>May 3, 2015: Notification of accepted talk abstracts emailed to authors</li> <li>July 8-9, 2015: <a href="https://www.open-bio.org/wiki/Codefest_2015">BOSC Codefest 2015</a>, Dublin</li> <li>July 10-11, 2015: <a href="https://www.open-bio.org/wiki/BOSC_2015">BOSC 2015</a>, Dublin</li> <li>July 10-14, 2015: <a href="http://www.iscb.org/ismbeccb2015">ISMB/ECCB 2015</a>, Dublin</li> </ul> <p>The Bioinformatics Open Source Conference (BOSC) covers the wide range of open source bioinformatics software being developed, and encompasses the growing movement of Open Science, with its focus on transparency, reproducibility, and data provenance. We welcome submissions relating to all aspects of bioinformatics and open science software, including new computational methods, reusable software components, visualization, interoperability, and other approaches that help to advance research in the biomolecular sciences. We particularly wish to invite those who have not participated in previous BOSCs to join us this year!</p> <p>Two full days of talks, posters, panel discussions, and informal discussion groups will enable BOSC attendees to interact with other developers and share ideas and code, as well as learning about some of the latest developments in the field of open source bioinformatics. BOSC is sponsored by the Open Bioinformatics Foundation, a non-profit, volunteer-run group dedicated to promoting the practice and philosophy of Open Source software development and Open Science within the biological research community.</p> <p>We invite you to submit one-page abstracts for talks and posters. As mentioned, any topics relevant to open source bioinformatics and open science are welcome. Here are some potential session topics (but please don&rsquo;t feel limited to these!):</p> <ul> <li>Open Science and Reproducible Research</li> <li>Standards and Interoperability</li> <li>Data Science</li> <li>Visualization</li> <li>Translational Bioinformatics</li> <li>Bioinformatics Open Source Libraries and Projects</li> </ul> <p>If your company or organization is interested in being a sponsor for BOSC 2015, please contact us! Sponsors of <a href="https://www.open-bio.org/wiki/BOSC_2014">BOSC 2014</a> included <a href="http://www.google.com/">Google</a>, <a href="http://www.eaglegenomics.com/">Eagle Genomics</a>, <a href="http://www.gigasciencejournal.com/">GigaScience</a>, and <a href="http://curoverse.com/">Curoverse</a> - we thank them for their support.</p> <p>BOSC 2015 Organizing Committee: Nomi Harris and Peter Cock (co-chairs), Raoul Jean Pierre Bonnal, Brad Chapman, Robert Davey, Christopher Fields, Sarah Hird, Karsten Hokamp, Hilmar Lapp, Monica Munoz-Torres.</p>https://www.open-bio.org/2015/03/03/sadly-obf-not-accepted-for-gsoc-2015/Tue, 03 Mar 2015 13:30:35 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2015/03/03/sadly-obf-not-accepted-for-gsoc-2015/<p>Last year&rsquo;s <a href="http://news.open-bio.org/news/2015/02/obf-gsoc-2014-wrapup/">Google Summer of Code 2014 was very productive for the OBF</a> with six students working on Bio* and related bioinformatics projects. We applied to be part of GSoC 2015, but unfortunately this year were not accepted.</p> <p>Google&rsquo;s program is enormously popular, and over-subscribed, meaning Google has had to rotate organisation membership. The OBF is grateful to have been accepted in 2010, 2011, 2012 and 2014. This year any participation will be down to individual projects to find a willing umbrella group from the <a href="https://www.google-melange.com/gsoc/org/list/public/google/gsoc2015">organisations accepted for GSoC 2015</a>. For example, a <a href="http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2013">Biopython project was included under NESCent for GSoC 2013</a>.</p> <p>Other organizations with bioinformatics as keyword are <a href="https://github.com/SciRuby/sciruby/wiki/Google-Summer-of-Code-2015-Ideas">Ruby Science Foundation</a>, <a href="https://docs.google.com/document/d/1zJGT5AwnKqx8mJLmoeRnM_iZkEk-i6Ky_M4b3Z38w6o/edit">Department of Biomedical Informatics, Stony Brook University</a>, <a href="http://bcb.dfci.harvard.edu/~cerami/gsoc.html">OncoBlocks</a>, <a href="http://helikarlab.org/GSoC.html">University of Nebraska - Helikar Lab</a>. Other organizations related to sciences are <a href="http://ascend4.org/Student_projects">ASCEND</a> , <a href="http://brlcad.org/wiki/Google_Summer_of_Code/Project_Ideas">BRL-CAD</a>, <a href="https://wiki.debian.org/SummerOfCode2015/Projects">Debian Project</a>, <a href="https://wiki.hpccsystems.com/display/hpcc/HPCC+Systems+GSoC+2015+Ideas+List">HPCC Systems®</a>,  <a href="https://www.incf.org/gsoc/2015/proposals">International Neuroinformatics Coordinating Facility</a> , <a href="http://wiki.lmona.de/get_involved/gsoc">lmonade:</a> <a href="http://wiki.lmona.de/get_involved/gsoc">scientific software distribution</a>, <a href="http://wiki.osgeo.org/wiki/Google_Summer_of_Code_2015_Ideas">OSGeo - Open Source Geospatial F</a> <a href="http://wiki.osgeo.org/wiki/Google_Summer_of_Code_2015_Ideas">oundation</a>, <a href="http://concord.org/GSoC">The Concord Consortium</a>, <a href="http://www.vtk.org/Wiki/VTK/GSoC_2015">The Visualization Toolkit</a>. Languages: <a href="https://www.google-melange.com/gsoc/org2/google/gsoc2015/python">Python</a>, <a href="https://www.google-melange.com/gsoc/org2/google/gsoc2015/scalateam">Scala</a>, <a href="https://www.google-melange.com/gsoc/org2/google/gsoc2015/apache">Apache Foundation</a>. Last but not least : <a href="https://docs.google.com/document/d/1PHPDTzD4Z6xVoxN0Q1F8yEPclSri-JA1vLvMTrLYUi8/edit">Global Alliance for Genomics &amp; Health</a>.</p> <p>On behalf of the OBF, we would like to thank our volunteer GSoC Administrators, Raoul Bonnal and Francesco Strozzi, for organising our application - and all our potential mentors across the Bio* projects who put forward potential project suggestions.</p>https://www.open-bio.org/2014/12/17/biopython-1-65-released/Wed, 17 Dec 2014 21:06:29 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2014/12/17/biopython-1-65-released/<p>Dear Biopythoneers,</p> <p>Source distributions and Windows installers for Biopython 1.65 are now available from the <a href="http://biopython.org/wiki/Download">downloads page</a> on the <a href="http://biopython.org/">official Biopython website</a> and from the <a href="https://pypi.python.org/pypi/biopython">Python Package Index (PyPI)</a>.</p> <p>This release of Biopython supports Python 2.6, 2.7, 3.3 and 3.4. It is also tested on PyPy 2.0 to 2.4, PyPy3 version 2,4, and Jython 2.7b2.</p> <p>The most visible change is that the Biopython <em><strong>sequence objects now use string comparison</strong></em>, rather than Python&rsquo;s object comparison. This has been planned for a long time with warning messages in place (under Python 2, the warnings were sadly missing under Python 3).</p> <p>The Bio.KEGG and Bio.Graphics modules have been expanded with support for the online KEGG REST API, and parsing, representing and drawing KGML pathways.</p> <p>The <em>Pterobranchia</em> Mitochondrial genetic code has been added to Bio.Data (and the translation functionality), which is the new <a href="http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi">NCBI genetic code</a> table 24.</p> <p>The Bio.SeqIO parser for the ABI capillary file format now exposes all the raw data in the SeqRecord&rsquo;s annotation as a dictionary. This allows further in-depth analysis by advanced users.</p> <p>Bio.SearchIO QueryResult objects now allow Hit retrieval using its alternative IDs (any IDs listed after the first one, for example as used with the NCBI BLAST NR database).</p> <p>Bio.SeqUtils.MeltingTemp has been rewritten with new functionality.</p> <p>The new experimental module Bio.CodonAlign has been renamed Bio.codonalign (and similar lower case PEP8 style module names have been used for the sub-modules within this).</p> <p>Bio.SeqIO.index_db(&hellip;) and Bio.SearchIO.index_db(&hellip;) now store any relative filenames relative to the index file, rather than (as before) relative to the current directory at the time the index was built. This makes the indexes less fragile, so that they can be used from other working directories. <em>NOTE:</em> This change is backward compatible (old index files work as before), however relative paths in new indexes will not work on older versions of Biopython!</p> <p>Behind the scenes, we have done a lot of work applying <a href="https://www.python.org/dev/peps/pep-0008/">PEP8 coding styles</a> to Biopython, and improving the formatting of the source code documentation ( <a href="https://www.python.org/dev/peps/pep-0257/">PEP257 docstrings</a>).</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Alan Du (first contribution)</li> <li>Carlos Pena (first contribution)</li> <li>Colin Lappala (first contribution)</li> <li>Christian Brueffer</li> <li>David Bulger (first contribution)</li> <li>Eric Talevich</li> <li>Evan Parker (first contribution)</li> <li>Hongbo Zhu</li> <li>Kai Blin</li> <li>Kevin Wu (first contribution)</li> <li>Leighton Pritchard</li> <li>Leszek Pryszcz (first contribution)</li> <li>Markus Piotrowski</li> <li>Matt Shirley (first contribution)</li> <li>Mike Cariaso (first contribution)</li> <li>Peter Cock</li> <li>Seth Sims (first contribution)</li> <li>Tiago Antao</li> <li>Travis Wrightsman (first contribution)</li> <li>Tyghe Vallard (first contribution)</li> <li>Vincent Davis</li> <li>Wibowo &lsquo;Bow&rsquo; Arindrarto</li> <li>Zheng Ruan</li> </ul> <p>This is a longer list of contributors and changes than usual, but it was also a longer gap since our last release.</p>https://www.open-bio.org/2014/09/18/bosc-2015-will-be-in-dublin/Thu, 18 Sep 2014 09:42:06 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2014/09/18/bosc-2015-will-be-in-dublin/<p>We have asked you, and you have spoken! 59 past and/or future BOSC attendees participated in our survey, answering questions about what they liked at BOSC 2014, what changes they&rsquo;d like to see, and — most importantly — what they thought about the proposal to possibly hold BOSC 2015 in Norwich (UK) rather than as an ISMB/ECCB SIG in Dublin (Ireland)..</p> <p>Under this plan, BOSC 2015 would have been shortly before ISMB/ECCB, but in Norwich. We would have been hosted by <a href="http://www.tgac.ac.uk">The Genome Analysis Centre (TGAC)</a> just after and co-located with the <a href="http://gcc2015.tsl.ac.uk">Galaxy Community Conference 2015</a> (GCC 2015, hosted by <a href="http://www.tsl.ac.uk">The Sainsbury Laboratory</a>). Although some survey participants indicated that they would be more likely to attend BOSC 2015 if it were co-located with GCC, the majority preferred BOSC to remain an ISMB SIG, so we will hold BOSC 2015 in Dublin right before ISMB/ECCB 2015.</p> <p>Here is the summary of responses to the questions about the location of BOSC 2015:</p> <p><img src="https://news.obf.io/wp-content/uploads/2014/09/BOSC2015_locations.png" alt="BOSC2015_locations"><img src="https://news.obf.io/wp-content/uploads/2014/09/BOSC2015_GCC.png" alt="BOSC2015_GCC"></p> <p>Although the survey is now closed, we are always happy to hear your suggestions for BOSC 2015. (We are particularly interested in increasing diversity at BOSC, and welcome suggestions of people to invite.) You can reach us at <a href="mailto:bosc@open-bio.org">bosc@open-bio.org</a></p> <p>Nomi Harris and Peter Cock Co-Chairs, BOSC 2015</p>https://www.open-bio.org/2014/04/26/obf-gsoc-students-2014/Sat, 26 Apr 2014 18:45:49 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2014/04/26/obf-gsoc-students-2014/<p>Hi all, I&rsquo;m pleased to announce the acceptance of OBF&rsquo;s <a href="https://www.google-melange.com/gsoc/homepage/google/gsoc2014">Google Summer of Code 2014 (GSoC)</a> students: <a href="https://www.google-melange.com/gsoc/homepage/google/gsoc2014"><img src="https://news.obf.io/wp-content/uploads/2014/01/GoogleSummer_2014logo-150x150.jpg" alt="[GSoC 2014 Logo]"></a></p> <ul> <li>Sarah Berkemer - &quot; <em>Open source high-performance BioHaskell</em>&quot; (Mentors: Christian Höner zu Siederdissen, Ketil Malde) ( <a href="http://biohaskell.org/GSoC_blog">blog</a>)</li> <li>Loris Cro - &quot; <em>An ultra-fast scalable RESTful API to query large numbers of VCF datapoints</em>&quot; (Mentors: Francesco Strozzi, Raoul Bonnal &amp; the BioRuby team) ( <a href="http://kappaloris.github.io/GSoC-2014-OBF/">blog</a>)</li> <li>Victor Kofia - &quot; <em>JSBML: Redesign the implementation of mathematical formulas</em>&quot; (Mentors: Alex Thomas, Sarah Keating &amp; the JSBML team) ( <a href="http://kofiav.blogspot.ca/">blog</a>)</li> <li>Evan Parker - &quot; <em>Addition of a lazy loading sequence parser to Biopython&rsquo;s SeqIO package</em>&quot; (Mentors: Wibowo Arindrarto, Peter Cock &amp; the Biopython team) ( <a href="http://evanaparker.com/">blog</a>)</li> <li>Ibrahim Vazirabad - &quot; <em>Improving the Plug-in interface for CellDesigner</em>&quot; (Mentors: Andreas Dräger, Alex Thomas &amp; the JSBML team) ( <a href="http://jsbmlcelldesigner2014.blogspot.com/">blog</a>)</li> <li>Leandro Watanabe - &quot; <em>Dynamic Modeling of Cellular Populations within JSBML</em>&quot; (Mentors: Nicolas Rodriguez, Chris Myers &amp; the JSBML team) ( <a href="http://lhwatanabe.blogspot.co.uk/">blog</a>)</li> </ul> <p>Congratulations to our accepted students!</p> <p>Thanks very much to all the students who applied, we very much appreciate your hard work.</p> <p>We are now in the GSoC Community Bonding Period. Official work starts on May 23rd, and until then, students should prepare for their projects: get on the project mailing lists, solidify your plans, figure out where all the version control repositories are and which branch or fork you&rsquo;ll be working on, and start doing preparatory work.</p> <p>Here&rsquo;s to a great 2014 Summer of Code,</p> <p>Eric &amp; Raoul</p> <p>OBF GSoC 2014 Organization Administrators</p>https://www.open-bio.org/2014/04/02/catering-at-bosc-codefest-2014/Wed, 02 Apr 2014 11:13:25 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2014/04/02/catering-at-bosc-codefest-2014/<p>Bioinformatics Open Source Codefest, July 9 and 10th in Boston, now with sponsored food and drinks!</p> <p>The OBF will be holding the fifth <a href="https://www.open-bio.org/wiki/Codefest">annual BOSC Codefest</a>, an informal two day &ldquo;hackathon&rdquo; or &ldquo;coding festival&rdquo; preceding the <a href="https://www.open-bio.org/wiki/BOSC_2014">Bioinformatics Open Source Conference (BOSC 2014)</a> in Boston (USA).</p> <p>This year, the BOSC Codefest 2014 is being hosted by <a href="http://www.hackreduce.org">hack/reduce</a> (a wonderful hackerspace in Cambridge, Boston) and has also been kindly sponsored by <a href="http://curoverse.com">Curoverse</a> (the team behind the open source platform <a href="http://arvados.org">Arvados</a>) and <a href="http://harbinger-partners.com/">Harbinger Partners, Inc.</a><a href="http://www.hackreduce.org/"><img src="https://www.open-bio.org/w/images/4/42/Hack-reduce-logo.png" alt=""></a><a href="http://curoverse.com/"><img src="https://www.open-bio.org/w/images/e/e5/Curoverse.png" alt=""></a><a href="http://harbinger-partners.com/"><img src="https://www.open-bio.org/w/images/a/ac/HP-logo-no-tagline.png" alt=""></a><a href="http://arvados.org/"><img src="https://www.open-bio.org/w/images/4/43/Arvados.png" alt=""></a> Thanks to this sponsorship, this year the organisers will able to include catering for the participants - I&rsquo;m expecting <em>at least</em> coffee and pizza, plus what ever caffeine rich drinks or local pastries are in fashion with the Boston programmers? I checked on wikipedia and <a href="http://en.wikipedia.org/wiki/Jolt_Cola">Jolt Cola</a> doesn&rsquo;t exist in the USA any more&hellip; so I&rsquo;m waiting to see what our local organisers Brad Chapman &amp; Michael Heuer have planned.</p> <p>If you are wondering what happens exactly at a CodeFest, I suggest Brad&rsquo;s <a href="http://bcbio.wordpress.com/2013/07/18/summary-from-bioinformatics-open-science-codefest-2013-tools-infrastructure-standards-and-visualization/">blog post from the BOSC Codefest 2013</a>, or <a href="http://journal.embnet.org/index.php/embnetjournal/article/view/726/998">Möller et al (2013)</a>. Basically these meeting are a chance for developers of open source bioinformatics (not just the OBF&rsquo;s Bio* projects) to get together and work on common interests. Things work best with some pre-meeting planning on the usual project development mailing lists or IRC, but are also a great way to meet other scientists and developers in person with more time to chat than during a conference coffee break.</p> <p>Please note that while there is no registration fee for the <a href="https://www.open-bio.org/wiki/Codefest_2014">BOSC Codefest 2014</a>, please do fill in the registration form to help with the planning/catering.</p> <p>We&rsquo;re hoping all the Codefest participants will stay for the BOSC meeting itself, which requires formal paid registration as one of the big ISCB 2014 conference&rsquo;s SIG satellite meetings. Note that we&rsquo;re offering a <a href="http://news.open-bio.org/news/2014/03/free-student-presenters-bosc-2014/">BOSC fee waiver for student speakers</a>, this year. If you are going to BOSC, please remember to <a href="http://news.open-bio.org/news/2014/03/bosc-2014-call-for-abstracts/">submit your BOSC abstracts</a> this week!</p> <p>Peter</p>https://www.open-bio.org/2014/03/19/free-student-presenters-bosc-2014/Wed, 19 Mar 2014 18:21:22 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2014/03/19/free-student-presenters-bosc-2014/<p><a href="https://www.open-bio.org/wiki/BOSC_2014"><img src="https://www.open-bio.org/w/images/b/b0/Pear.png" alt=""></a> To encourage more student presentations at the Bioinformatics Open Source Conference (BOSC), this year we&rsquo;re waiving the registration fee for accepted student presenters. When you submit your abstract ( <a href="http://news.open-bio.org/news/2014/03/bosc-2014-call-for-abstracts/">BOSC abstract call open until 4th April</a>), you must tick the student box:</p> <p><em>Student submissions must have a full-time student as the first named and presenting author, and be mostly written by students.</em></p> <p>Please note that because BOSC registration is via the ISCB as <a href="https://www.iscb.org/ismb2014-program/ismb2014-sigs-satellite-meetings#bosc">one of the ISCM SIG meetings</a>, eligible students must contact us <strong><em>before</em></strong> filling in their ISCB registration to ensure the BOSC SIG fee is waived. <a href="http://www.eaglegenomics.com/"><img src="https://www.open-bio.org/w/images/thumb/5/5f/Eagle_logo_2013.jpg/120px-Eagle_logo_2013.jpg" alt=""></a></p> <p>Furthermore, as in previous years, BOSC Student Travel Awards sponsored by <a href="http://www.eaglegenomics.com/">Eagle Genomics</a> will be awarded to the top student presentations to help with your travel and accommodation costs.</p> <p><strong>Update (2 May 2014):</strong> We&rsquo;ve just sent out the accepted talk invitations, and are offering a registration fee waiver to four student speakers.</p>https://www.open-bio.org/2014/03/04/bosc-2014-call-for-abstracts/Tue, 04 Mar 2014 18:18:57 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2014/03/04/bosc-2014-call-for-abstracts/<p>Call for Abstracts for the 15th Annual Bioinformatics Open Source Conference (BOSC 2014), a Special Interest Group (SIG) of ISMB 2014.</p> <p><a href="https://www.open-bio.org/wiki/BOSC_2014"><img src="https://www.open-bio.org/w/images/b/b0/Pear.png" alt="[BOSC Logo]"></a></p> <ul> <li>Dates: July 11-12, 2014</li> <li>Location: Boston, MA, USA</li> <li>Web site: <a href="https://www.open-bio.org/wiki/BOSC_2014">/wiki/BOSC_2014</a></li> <li>Email: <a href="mailto:bosc@open-bio.org">bosc@open-bio.org</a></li> <li><a href="http://lists.open-bio.org/mailman/listinfo/bosc-announce">BOSC announcements mailing list</a></li> <li>Twitter: <a href="https://twitter.com/OBF_BOSC" title="OBF Bioinformatics Open Source Conference (BOSC)">@OBF_BOSC</a> and <a href="https://twitter.com/OBF_news" title="Open Bioinformatics Foundation (OBF) News">@OBF_News</a></li> </ul> <p>Important Dates:</p> <ul> <li>March 24, 2014: <a href="https://www.iscb.org/ismb2014-registration">Registration opens for ISMB and BOSC</a></li> <li>April 4, 2014: Deadline for <a href="https://www.open-bio.org/wiki/BOSC_Abstract_Submission" title="BOSC abstract submission">submitting BOSC abstracts</a></li> <li>May 1, 204: Notification of accepted talk abstracts emailed to authors</li> <li>July 9-10, 2014: <a href="https://www.open-bio.org/wiki/Codefest_2014" title="BOSC Codefest 2014">BOSC Codefest 2014</a>, Boston</li> <li>July 11-12, 2014: <a href="https://www.open-bio.org/wiki/BOSC_2014" title="BOSC 2014">BOSC 2014</a>, Boston</li> <li>July 11-15, 2014: <a href="https://www.iscb.org/ismb2014" title="ISMB 2014 conference">ISMB 2014</a>, Boston</li> </ul> <p>The Bioinformatics Open Source Conference (BOSC) covers the wide range of open source bioinformatics software being developed, and encompasses the growing movement of Open Science, with its focus on transparency, reproducibility, and data provenance. We welcome submissions relating to all aspects of bioinformatics and open science software, including new computational methods, reusable software components, visualization, interoperability, and other approaches that help to advance research in the biomolecular sciences. Two full days of talks, posters, panel discussions, and informal discussion groups will enable BOSC attendees to interact with other developers and share ideas and code, as well as learning about some of the latest developments in the field of open source bioinformatics.</p> <p>BOSC is sponsored by the Open Bioinformatics Foundation, a non-profit, volunteer-run group dedicated to promoting the practice and philosophy of Open Source software development and Open Science within the biological research community.</p> <p>We invite you to submit one-page abstracts for talks and posters. This year&rsquo;s session topics are:</p> <p><a href="http://www.eaglegenomics.com/"><img src="https://www.open-bio.org/w/images/thumb/5/5f/Eagle_logo_2013.jpg/120px-Eagle_logo_2013.jpg" alt="[Eagle Genomics Logo]"></a></p> <ul> <li>Open Science and Reproducible Research</li> <li>Software Interoperability</li> <li>Genome-scale Data and Beyond</li> <li>Visualization</li> <li>Translational Bioinformatics</li> <li>Bioinformatics Open Source Libraries and Projects</li> </ul> <p><a href="http://www.gigasciencejournal.com/"><img src="https://www.open-bio.org/w/images/thumb/b/bb/Gigascience-07.png/200px-Gigascience-07.png" alt="GigaScience Journal Logo"></a></p> <p>Once again we thank <a href="http://www.eaglegenomics.com/">Eagle Genomics</a> for sponsoring the BOSC Student Travel Awards, and welcome the open access journal <a href="http://www.gigasciencejournal.com/">GigaScience</a> as a new sponsor for BOSC 2014.</p> <p>BOSC 2014 Organizing Committee: Nomi Harris and Peter Cock (co-chairs), Raoul Jean Pierre Bonnal, Brad Chapman, Robert Davey, Christopher Fields, Hans-Rudolf Hotz, Hilmar Lapp</p>https://www.open-bio.org/2013/12/24/bosc-2014-keynote-speakers/Tue, 24 Dec 2013 05:34:18 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2013/12/24/bosc-2014-keynote-speakers/<p>Thanks to those who participated in the <a href="http://news.open-bio.org/news/2013/12/bosc-2014-keynote-competition/">BOSC 2014 Keynote Competition</a>! Our winner is Manuel Corpas, who correctly surmised <a href="https://twitter.com/pebourne">Philip Bourne</a>:</p> <p><a href="https://twitter.com/manuelcorpas/status/412520369044463616">https://twitter.com/manuelcorpas/status/412520369044463616</a></p> <p>(In fact, we had already confirmed Philip Bourne as our second keynote speaker <em>before</em> his new job at NIH was announced.) Congratulations, Manuel, on winning free admission to <a href="https://www.open-bio.org/wiki/BOSC_2014">BOSC 2014</a>!</p> <p>Dr. Bourne&rsquo;s keynote talk will be entitled &ldquo;Biomedical Research as an Open Digital Enterprise&rdquo;:</p> <blockquote> <p>The biomedical research lifecycle is fast becoming completely digital and increasingly open to the point that publishing could simply become changing the access control on given research objects comprising ideas, hypotheses, data, software, results, conclusions, reviews, grants and so on. This offers immense opportunities for software developers to enable the enterprise. I will describe a vision for the digital enterprise and what the NIH and others are doing to support the notion with the intent to accelerate scientific discovery.</p> </blockquote> <p>Our other keynote speaker at BOSC 2014, as already announced, will be <a href="https://twitter.com/ctitusbrown">Titus Brown</a>, whose topic is &ldquo;A History of Bioinformatics (in the Year 2039)&rdquo;.</p>https://www.open-bio.org/2013/12/13/bosc-2014-keynote-competition/Fri, 13 Dec 2013 12:24:53 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2013/12/13/bosc-2014-keynote-competition/<p>We&rsquo;re pleased to officially confirm that one of the two keynote speakers for the 15th annual Bioinformatics Open Source Conference ( <a href="https://www.open-bio.org/wiki/BOSC_2014">BOSC 2014</a>) will be C. Titus Brown, as he announced on Twitter recently:</p> <blockquote> <p><a href="https://twitter.com/ctitusbrown/">Titus Brown (@ctitusbrown):</a> <a href="https://twitter.com/ctitusbrown/"><img src="https://pbs.twimg.com/profile_images/2341608206/1v12iz3xg0w80911u76a_normal.png" alt="C. Titus Brown"></a> Excited to be a keynote speaker at BOSC 2014! My title: &ldquo;A History of Bioinformatics (in the year 2039)&rdquo; - plenty of room for mischief ;) <a href="https://twitter.com/ctitusbrown/status/410934403565490176">https://twitter.com/ctitusbrown/status/410934403565490176</a></p> </blockquote> <p>In recognition of the growing use of Twitter and social media within science as a way of connecting across geographical divides, we&rsquo;re announcing a Twitter competition to guess who is scheduled to give the second keynote at BOSC 2014 in Boston.</p> <p>To enter, please tweet using <a href="https://twitter.com/search?q=%23bosc2014" title="#BOSC2014 on Twitter">hashtag #bosc2014</a> and include us via <a href="https://twitter.com/OBF_BOSC" title="@OBF_BOSC on Twitter">@OBF_BOSC</a>, e.g.</p> <blockquote> <p>I think @OBF_BOSC should invite &ldquo;Professor X&rdquo; to be a keynote speaker at #BOSC2014 because &hellip;</p> </blockquote> <p>The first correct entry (within one week) will be awarded one complementary BOSC 2014 registration fee for themselves, or a nominated group member. This does not cover travel or accommodation, and there is no cash substitute if you cannot attend BOSC 2014. Members of the OBF board, BOSC organizing committee, and ISMB SIG committee are not eligible, nor are the keynote speakers themselves.</p> <p>We intend to announce the mystery keynote speaker and any Twitter competition winner in one week&rsquo;s time, but reserve the right to cut short, modify, or cancel the competition.</p> <p>Our ulterior motive is to crowd source ideas for future keynote speakers in BOSC 2015, so some serious suggestions please ;)</p> <p>Further details about BOSC 2014 will be posted here: <a href="https://www.open-bio.org/wiki/BOSC_2014">/wiki/BOSC_2014</a></p> <p>Thank you,</p> <p>Peter Cock &amp; Nomi Harris, BOSC 2014 co-chairs.</p>https://www.open-bio.org/2013/07/17/bosc-2013/Wed, 17 Jul 2013 14:33:58 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2013/07/17/bosc-2013/<p>Hello from Berlin, where the pre-BOSC informal <a href="https://www.open-bio.org/wiki/Codefest_2013">CodeFest 2013</a> meeting is already underway. We&rsquo;re looking forward to seeing even more of you on Friday and Saturday for <a href="https://www.open-bio.org/wiki/BOSC_2013">BOSC 2013</a>.</p> <p>BOSC 2013 will be the 14th annual <em>Bioinformatics Open Source Conference</em>, and is organised by the Open Bioinformatics Foundation (OBF). It is held as a Special Interest Group (SIG) meeting in conjunction with the ISMB conference, which itself is held jointly with the ECCB meeting every second year. This year the <a href="http://www.iscb.org/ismbeccb2013">ISMB/ECCB 2013 is in Berlin</a>, Germany.</p> <p>You can follow <a href="https://twitter.com/OBF_BOSC">BOSC on Twitter @OBF_BOSC</a>, and we&rsquo;ll be using the <a href="https://twitter.com/search?q=%23BOSC2013">Twitter Hashtag #BOSC2013</a>.</p> <p>We also have a low-volume <a href="http://lists.open-bio.org/mailman/listinfo/bosc-announce">BOSC announcements mailing list</a>, please sign up if you&rsquo;d consider attending or submitting a talk or poster for next year - BOSC 2014 and the ISMB 2014 will be in Boston, USA in July 2014.</p>https://www.open-bio.org/2013/02/05/biopython-1-61-released/Tue, 05 Feb 2013 21:14:05 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2013/02/05/biopython-1-61-released/<p>Source distributions and Windows installers for Biopython 1.61 are now available from the <a href="http://biopython.org/wiki/Download">downloads page</a> on the <a href="http://biopython.org/">Biopython website</a> and from the <a href="http://pypi.python.org/pypi/biopython">Python Package Index (PyPI)</a>.</p> <p>The updated <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial and Cookbook</a> is online ( <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>).</p> <p><strong>Platforms/Deployment</strong></p> <p>We currently support Python 2.5, 2.6 and 2.7 and also test under Python 3.1, 3.2 and 3.3 (including modules using NumPy), and <a href="http://www.jython.org">Jython</a> 2.5 and <a href="http://pypy.org">PyPy</a> 1.9 (Jython and PyPy do not cover NumPy or our C extensions). We are still encouraging early adopters to help test on these platforms, and have included a ‘beta’ installer for Python 3.2 (and Python 3.3 to follow soon) under 32-bit Windows.</p> <p>Please note we are phasing out support for Python 2.5. We will continue support for at least one further release (Biopython 1.62). This could be extended given feedback from our users. Focusing on Python 2.6 and 2.7 only will make writing Python 3 compatible code easier.</p> <p><strong>Features</strong></p> <p>GenomeDiagram has three new sigils (shapes to illustrate features). OCTO shows an octagonal shape, like the existing BOX sigil but with the corners cut off. JAGGY shows a box with jagged edges at the start and end, intended for things like NNNNN regions in draft genomes. Finally BIGARROW is like the existing ARROW sigil but is drawn straddling the axis. This is useful for drawing vertically compact figures where you do not have overlapping genes.</p> <p>New module Bio.Graphics.ColorSpiral can generate colors along a spiral path through HSV color space. This can be used to make arbitrary &lsquo;rainbow&rsquo; scales, for example to color features or cross-links on a GenomeDiagram figure.</p> <p>The Bio.SeqIO module now supports reading sequences from PDB files in two different ways. The &ldquo;pdb-atom&rdquo; format determines the sequence as it appears in the structure based on the atom coordinate section of the file (via Bio.PDB, so NumPy is currently required for this). Alternatively, you can use the &ldquo;pdb-seqres&rdquo; format to read the complete protein sequence as it is listed in the PDB header, if available.</p> <p>The Bio.SeqUtils module how has a seq1 function to turn a sequence using three letter amino acid codes into one using the more common one letter codes. This acts as the inverse of the existing seq3 function.</p> <p>The multiple-sequence-alignment object used by Bio.AlignIO etc now supports an annotation dictionary. Additional support for per-column annotation is planned, with addition and splicing to work like that for the SeqRecord per-letter annotation.</p> <p>The Bio.Motif module has been updated and reorganized. To allow for a clean deprecation of the old code, the new motif code is stored in a new module Bio.motifs, and a PendingDeprecationWarning was added to Bio.Motif.</p> <p><strong>Experimental Code - SearchIO</strong></p> <p>This release also includes <a href="http://biopython.org/wiki/SearchIO">Bow&rsquo;s Google Summer of Code work</a> writing a unified parsing framework for NCBI BLAST (assorted formats including tabular and XML), HMMER, BLAT, and other sequence searching tools. This is currently available with the new <code>BiopythonExperimentalWarning</code> to indicate that this is still somewhat experimental. We&rsquo;re bundling it with the main release to get more public feedback, but with the big warning that the API is likely to change. In fact, even the current name of Bio.SearchIO may change since unless you are familiar with BioPerl its purpose isn&rsquo;t immediately clear.</p> <p><strong>Contributors</strong></p> <ul> <li>Brandon Invergo</li> <li>Bryan Lunt (first contribution)</li> <li>Christian Brueffer (first contribution)</li> <li>David Cain</li> <li>Eric Talevich</li> <li>Grace Yeo (first contribution)</li> <li>Jeffrey Chang</li> <li>Jingping Li (first contribution)</li> <li>Kai Blin (first contribution)</li> <li>Leighton Pritchard</li> <li>Lenna Peterson</li> <li>Lucas Sinclair (first contribution)</li> <li>Michiel de Hoon</li> <li>Nick Semenkovich (first contribution)</li> <li>Peter Cock</li> <li>Robert Ernst (first contribution)</li> <li>Tiago Antao</li> <li>Wibowo &lsquo;Bow&rsquo; Arindrarto</li> </ul>https://www.open-bio.org/2012/11/06/obf-board-meeting-13-nov/Tue, 06 Nov 2012 15:58:44 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2012/11/06/obf-board-meeting-13-nov/<p>The Open Bioinformatics Foundation (OBF) will be holding a public <a href="https://www.open-bio.org/wiki/Board">Board of Directors</a> meeting on Tuesday, 13 Nov, 2012, at 11.30am EST (8.30am PST, 17:30 CET, 16:30 UTC/GMT).</p> <p>The meeting will be held online or over conference call. We will post details about how to dial in or connect closer to the date ( <a href="https://www.open-bio.org/wiki/Minutes:2012_Nov_ConfCall">here</a>).</p> <p>On the agenda Richard Holland and Chris Fields are running for election to the Board, and some other items primarily up for discussion, including how to keep our membership roll up-to-date and increasing with the least barriers. We will post a more detailed agenda in advance of the meeting ( <a href="https://www.open-bio.org/wiki/Minutes:2012_Nov_ConfCall">here</a>).</p> <p>OBF members should have already received notice of this meeting via the <a href="http://lists.open-bio.org/mailman/listinfo/members">OBF member’s mailing list</a>.</p>https://www.open-bio.org/2012/10/12/obf-now-spi-associated/Fri, 12 Oct 2012 19:01:49 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2012/10/12/obf-now-spi-associated/<p>I am very pleased to announce that the Open Bioinformatics Foundation (O|B|F) is now a <a href="http://www.spi-inc.org">Software in the Public Interest (SPI)</a> associated project, rather than its own not-for-profit incorporation.</p> <p>An electronic vote of O|B|F members on whether or not to provisionally approve the invitation from SPI closed yesterday at 19:00 UTC. We had a participation of 39 out of 105 eligible, or 37%, which is far above the quorum of 10%. The tally is 38 for provisionally accepting and 1 against. The tally can be seen (and audited) here: <a href="https://vote.heliosvoting.org/helios/e/OBFjoiningSPI">https://vote.heliosvoting.org/helios/e/OBFjoiningSPI</a></p> <p>The SPI Board vote on resolution <a href="http://www.spi-inc.org/meetings/agendas/2012/2012-10-11/">2012-09-28.jb.1</a> (&ldquo;Open Bioinformatics Foundation as associated project&rdquo;) resulted in 8 yes, 0 no, 0 abstain. Given the result of our election, I accepted the invitation right away.</p> <p>Thanks to everyone who voted. On behalf of the Board, I am thrilled about the turnout!</p> <p>This terminates O|B|F&rsquo;s status as its own corporation, which over the years has been more trouble than gain. As an SPI-associated project, we can now accept donations that are 501(c)3 tax-exempt in the US, aside from other <a href="http://www.spi-inc.org/projects/services/">benefits</a>. In the coming weeks and months we will be articulating what kind of objectives, platforms, and activities we can or should pursue, given our new status. I&rsquo;ll communicate separately about that once it gets off the ground.</p> <p>Finally, please join me in thanking Josh Berkus (SPI &amp; PostgreSQL) for shepherding our joining SPI all the way through. And please also join me in saying hi to the SPI community - as I have done earlier I&rsquo;d like to encourage everyone to consider joining the SPI as well. It&rsquo;s a friendly community, and I like to think we can enrich it.</p> <p>This is a historic day for our organization. Have a drink tonight :-)</p> <p>Cheers,</p> <p>-hilmar</p> <p>Note: This post is based on an email sent yesterday to the <a href="http://lists.open-bio.org/mailman/listinfo/members">OBF member&rsquo;s mailing list</a>.</p>https://www.open-bio.org/2012/07/30/travis-ci-for-testing/Mon, 30 Jul 2012 13:24:09 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2012/07/30/travis-ci-for-testing/<p>Earlier this year <a href="http://bioruby.org">BioRuby</a> and then <a href="http://biopython.org">Biopython</a> and <a href="http://bioperl.org">BioPerl</a> started using <a href="http://travis-ci.org">Travis-CI.org</a>, a hosted continuous integration service for the open source community, to run their unit tests automatically whenever their <a href="http://github.com">GitHub</a> repositories are updated:</p> <ul> <li><a href="http://travis-ci.org/bioruby/bioruby/"><img src="https://secure.travis-ci.org/bioruby/bioruby.png?branch=master" alt="BioRuby on Travis-CI.org"></a><a href="http://travis-ci.org/bioruby/bioruby/">BioRuby</a></li> <li><a href="http://travis-ci.org/biopython/biopython/"><img src="https://secure.travis-ci.org/biopython/biopython.png?branch=master" alt="Biopython on Travis-CI.org"></a><a href="http://travis-ci.org/biopython/biopython/">Biopython</a></li> <li><a href="http://travis-ci.org/bioperl/bioperl-live/"><img src="https://secure.travis-ci.org/bioperl/bioperl-live.png?branch=master" alt="BioPerl on Travis-CI.org"></a><a href="http://travis-ci.org/bioperl/bioperl-live/">BioPerl</a></li> </ul> <p>The BioRuby team are also using Travis-CI for automated testing of their new &lsquo;plugin&rsquo; ecosystem, BioRuby Gems, or <a href="http://www.biogems.info/">BioGems</a>.</p> <p>Travis-CI gives us continuous testing, but for the moment only covers <a href="http://about.travis-ci.org/docs/user/ci-environment/">one operating system</a> (currently 32 bit Ubuntu Linux using Virtual Machines). This automated testing is therefore complementary to our existing <a href="http://testing.open-bio.org/">OBF BuildBot server</a> which aims to run nightly tests on volunteer developer machines setup to cover a broad range of operating systems and configurations.</p> <p>However, Travis-CI are working on a new feature - <a href="http://about.travis-ci.org/blog/announcing-pull-request-support/">automatic testing of pull requests</a>, currently only available on a donation basis - which the OBF was happy to support.</p> <p>What this means is that when a contributor has some code ready for integration, they can issue a <a href="https://help.github.com/articles/using-pull-requests/">GitHub pull request</a>, and then Travis-CI will automatically run the unit tests with those proposed changes. This is something that currently the core-developers would normally do manually as part of evaluating proposed changes, so having this happen automatically should be a big help.</p> <p>We&rsquo;re excited about making more use of Travis-CI for other <a href="https://www.open-bio.org/wiki/Projects">OBF projects</a>. Thus far we&rsquo;ve been really impressed with Travis-CI.</p>https://www.open-bio.org/2012/04/24/students-selected-for-gsoc/Tue, 24 Apr 2012 09:08:35 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2012/04/24/students-selected-for-gsoc/<p>Hello all,</p> <p>I&rsquo;m very pleased and excited to announce that the Open Bioinformatics Foundation has selected 5 very capable students to work on OBF projects this summer as part of the <a href="http://code.google.com/soc/">Google Summer of Code (GSoC) program</a>.</p> <p>The accepted students, their projects, and their mentors (in alphabetical order):</p> <ul> <li><strong><a href="http://bow.web.id/blog/tag/gsoc/">Wibowo Arindrarto</a></strong>: <em>SearchIO Implementation in Biopython</em> mentored by Peter Cock</li> <li><strong><a href="http://arklenna.tumblr.com/tagged/gsoc2012">Lenna Peterson</a></strong>: <em>Diff My DNA: Development of a Genomic Variant Toolkit for Biopython</em> mentored by Brad Chapman, Reece Hart, James Casbon</li> <li><strong><a href="http://blog.mpthecoder.com/tagged/gsoc">Marjan Povolni</a></strong>: <em>The worlds fastest parallelized GFF3/GTF parser in D, and an interfacing biogem plugin for Ruby</em> mentored by Pjotr Prins, Francesco Strozzi, Raoul Bonnal</li> <li><strong><a href="http://lomereiter.wordpress.com/tag/gsoc/">Artem Tarasov</a></strong>: <em>Fast parallelized GFF3/GTF parser in C++, with Ruby FFI bindings</em> mentored by Pjotr Prins, Francesco Strozzi, Raoul Bonnal</li> <li><strong><a href="http://csw.github.com/bioruby-maf/">Clayton Wheeler</a></strong>: <em>Multiple Alignment Format parser for BioRuby</em> mentored by Francesco Strozzi and Raoul Bonnal</li> </ul> <p>As in every year, we received many great applications and ideas. However, funding and mentor resources are limited, and we were not able to accept as many as we would have liked. Our deepest thanks to all the students who applied: we sincerely appreciate the time and effort you put into your applications, and hope you will still consider being a part of the OBF&rsquo;s open source projects, even without Google funding. I speak for myself and all of the mentors who read and scored applications when I say that we were truly honored by the number and quality of the applications we received.</p> <p>For the accepted students: congratulations! You have risen to the top of a very competitive application process. Now it&rsquo;s time to &ldquo;put your money where your mouth is&rdquo;, as the saying goes. Let&rsquo;s get out there and write some great code this summer!</p> <p>Best regards,</p> <p>Robert Buels OBF GSoC 2012 Organization Administrator</p>https://www.open-bio.org/2012/03/25/obf-summer-of-code-2012/Sun, 25 Mar 2012 21:27:05 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2012/03/25/obf-summer-of-code-2012/<p>Applications due 19:00 UTC, April 6, 2012. <a href="https://www.open-bio.org/wiki/Google_Summer_of_Code">/wiki/Google_Summer_of_Code</a></p> <p>The Open Bioinformatics Foundation (OBF) Summer of Code program provides a unique opportunity for undergraduate, masters, and PhD students to obtain hands-on experience writing and extending open-source software for bioinformatics under the mentorship of experienced developers from around the world. The program is the participation of the Open Bioinformatics Foundation (OBF) as a mentoring organization in the <a href="http://code.google.com/soc/">Google Summer of Code (GSoC)</a>.</p> <p>Students successfully completing the 3 month program receive a $5,000 USD stipend, and may work entirely from their home or home institution. Participation is open to students from any country in the world except countries subject to US trade restrictions. Each student will have at least one dedicated mentor to show them the ropes and help them complete their project.</p> <p>The Open Bioinformatics Foundation is particularly seeking students interested in both bioinformatics (computational biology) and software development. Some <a href="https://www.open-bio.org/wiki/Google_Summer_of_Code">initial project ideas are listed on the website</a>. These range from sequence search I/O in <a href="http://biopython.org/wiki/Google_Summer_of_Code">Biopython</a> to lightweight sequence objects and lazy parsing in <a href="http://bioperl.org/wiki/Google_Summer_of_Code">BioPerl</a>, a next-generation <a href="http://www.bioruby.org/wiki/Google_Summer_of_Code">BioRuby</a> interface to Ensembl to developing cloud-optimized versions of <a href="http://biojava.org/wiki/Google_Summer_of_Code">BioJava</a> modules. All project ideas are flexible and many can be adjusted in scope to match the skills of the student. We also particularly welcome and encourage students proposing their own project ideas; historically some of the most successful Summer of Code projects are ones proposed by the students themselves.</p> <p><strong>TO APPLY:</strong> Apply online at the Google Summer of Code website (<a href="http://socghop.appspot.com/)">http://socghop.appspot.com/)</a>, where you will also find GSoC program rules and eligibility requirements. The 12-day application period for students runs from Monday, March 26 through Friday, April 6th, 2012.</p> <p><strong>INQUIRIES:</strong></p> <p>We strongly encourage all interested students to get in touch with us with their ideas as early on as possible. See the OBF GSoC page for contact details.</p> <p>2012 OBF Summer of Code: <a href="https://www.open-bio.org/wiki/Google_Summer_of_Code">/wiki/Google_Summer_of_Code</a></p> <p>Google Summer of Code FAQ: <a href="http://www.google-melange.com/document/show/gsoc_program/google/gsoc2012/faqs">http://www.google-melange.com/document/show/gsoc_program/google/gsoc2012/faqs</a></p> <p>Rob Buels OBF GSoC 2012 Admin</p>https://www.open-bio.org/2012/03/16/obf-accepted-for-gsoc-2012/Fri, 16 Mar 2012 21:53:04 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2012/03/16/obf-accepted-for-gsoc-2012/<p>Google announced today that the <a href="http://open-bio.org/">Open Bioinformatics Foundation (OBF)</a> has been accepted as a mentoring organization for <a href="http://www.google-melange.com/gsoc/homepage/google/gsoc2012">Google Summer of Code 2012</a>!</p> <p><a href="http://code.google.com/soc/"><img src="http://code.google.com/images/GSoC2012_300x200.png" alt="GSoC 2012 Logo"></a><a href="http://code.google.com/soc/">Google Summer of Code (GSoC)</a> is a Google-sponsored student internship program for open-source projects, open to students from around the world (not just US residents). Students are paid a $5000 USD stipend to work as a developer on an open-source project for the summer. For more on GSoC, see the <a href="http://www.google-melange.com/document/show/gsoc_program/google/gsoc2012/faqs">GSoC 2012 FAQ</a>.</p> <p>Student applications are due April 6, 2012 at 19:00 UTC. Students who are interested in participating should look at the <a href="http://open-bio.org/wiki/Google_Summer_of_Code">OBF&rsquo;s GSoC page</a>, which lists project ideas, and whom to contact about applying.</p> <p>For current developers on OBF projects, please consider volunteering to be a mentor if you have not already, and contribute project ideas. Just list your name and project ideas on OBF wiki and on the relevant project&rsquo;s GSoC wiki page.</p> <p>Thanks to all who helped make OBF&rsquo;s application to GSoC a success, and let&rsquo;s have a great, productive summer of code!</p> <p>Rob Buels OBF GSoC 2012 Administrator</p>https://www.open-bio.org/2012/03/05/call-for-abstracts-for-bosc-2012/Mon, 05 Mar 2012 19:54:28 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2012/03/05/call-for-abstracts-for-bosc-2012/<p>Call for Abstracts for the 13th Annual <a href="https://www.open-bio.org/wiki/BOSC_2012">Bioinformatics Open Source Conference (BOSC 2012)</a>, a Special Interest Group (SIG) of <a href="http://www.iscb.org/ismb2012">ISMB 2012</a>.</p> <p>Dates: July 13-14, 2012 Location: Long Beach, California Web site: <a href="https://www.open-bio.org/wiki/BOSC_2012">/wiki/BOSC_2012</a> Email: <a href="mailto:bosc@open-bio.org">bosc@open-bio.org</a> BOSC announcements mailing list: <a href="http://lists.open-bio.org/mailman/listinfo/bosc-announce">http://lists.open-bio.org/mailman/listinfo/bosc-announce</a></p> <p>Important Dates:</p> <ul> <li>April 13, 2012: Deadline for submitting abstracts</li> <li>May 7, 2012: Notification of accepted talk abstracts emailed to authors</li> <li>July 11-12, 2012: Codefest 2012 programming session</li> <li>July 13-14, 2012: <a href="https://www.open-bio.org/wiki/BOSC_2012">BOSC 2012</a></li> <li>July 15-17, 2012: <a href="http://www.iscb.org/ismb2012">ISMB 2012</a></li> </ul> <p>The Bioinformatics Open Source Conference (BOSC) is sponsored by the Open Bioinformatics Foundation (O|B|F), a non-profit group dedicated to promoting the practice and philosophy of Open Source software development within the biological research community. To be considered for acceptance, software systems representing the central topic in a presentation submitted to BOSC must be licensed with a recognized Open Source License, and be freely available for download in source code form.</p> <p>We invite you to submit one-page abstracts for talks and posters. This year&rsquo;s session topics are:</p> <ul> <li>Cloud and Parallel Computing</li> <li>Linked Data</li> <li>Genome-scale Data Management</li> <li>Data Visualization and Imaging</li> <li>Translational Bioinformatics</li> <li>Software Interoperability (possibly a joint session with <a href="http://www.broadinstitute.org/software/bsi-sig/">BSI-SIG, the Bioinformatics Software Interoperability SIG</a>)</li> <li>Bioinformatics Open Source Project Updates</li> <li>Interfacing with Industry (panel)</li> </ul> <p>Thanks to generous sponsorship from <a href="http://eaglegenomics.com/">Eagle Genomics</a> and an anonymous donor, we are pleased to announce a competition for three Student Travel Awards. Each winner will be awarded $250 to defray the costs of travel to BOSC 2012.</p> <p>For instructions on submitting your abstract, please visit <a href="https://www.open-bio.org/wiki/BOSC_2012#Submitting_Abstracts">/wiki/BOSC_2012#Submitting_Abstracts</a></p> <p>BOSC 2012 Organizing Committee: Nomi Harris (chair), Jan Aerts, Brad Chapman, Peter Cock, Chris Fields, Erwin Frise, Peter Rice</p>https://www.open-bio.org/2012/03/02/cross-links-in-genomediagram/Fri, 02 Mar 2012 16:56:38 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2012/03/02/cross-links-in-genomediagram/<p>I&rsquo;ve just finished writing up an example for the Biopython Tutorial of the new GenomeDiagram functionality added in <a href="http://news.open-bio.org/news/2012/02/biopython-1-59-released/">Biopython 1.59</a>. You can now control the start and end points of individual tracks, and you can add cross-links between regions of different tracks, as shown here:</p> <p><a href="https://www.open-bio.org/wp-content/uploads/2012/03/three_track_cl2.png"><img src="https://news.obf.io/wp-content/uploads/2012/03/three_track_cl2-1024x724.png" alt="GenomeDiagram with cross-links between tracks"></a></p> <p>This example attempts a simplified reproduction of Figure 6 in <a href="http://dx.doi.org/10.1128/%E2%80%8BJB.184.21.6026-6036.2002">Proux et al. (2002)</a>, and shows three related phage genomes one above the other. Different classes of genes have been given different colors, while the strength of the red shaded cross-links indicates the percentage identity of the linked genes. Note there are some minor differences in the GenBank annotation we&rsquo;ve used and the genes shown in the original figure.</p> <p>Note while this example is in the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Tutorial HTML</a> and <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a> online, it was not in the zip/tarball for Biopython 1.59, and nor was the <a href="https://github.com/biopython/biopython/blob/master/Doc/examples/Proux_et_al_2002_Figure_6.py">Proux_et_al_2002_Figure_6.py</a> script. It will be in future releases.</p> <p>Another motivating use case for this functionality was to produce vector images of whole genome alignments in the style of the <a href="http://www.sanger.ac.uk/resources/software/act/">Artemis Comparison Tool (ACT)</a> or <a href="http://asap.ahabs.wisc.edu/mauve/">Mauve</a>. We&rsquo;ve got a poster printer in the building just crying out to be used for showing whole genome comparison of a dozen bacteria strains!</p>https://www.open-bio.org/2012/02/24/biopython-1-59-released/Fri, 24 Feb 2012 15:09:04 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2012/02/24/biopython-1-59-released/<p>Source distributions and Windows installers for <strong>Biopython 1.59</strong> are now available from the <a href="http://biopython.org/wiki/Download">downloads page</a> on the <a href="http://biopython.org/">Biopython website</a> and from the <a href="http://pypi.python.org/pypi/biopython">Python Package Index (PyPI)</a>.</p> <h3 id="platformsdeployment">Platforms/Deployment</h3> <p>We currently support <a href="http://python.org">Python</a> 2.5, 2.6 and 2.7 and also test under <a href="http://jython.org">Jython</a> 2.5 (which does not cover NumPy). Please note that this release will not work on Python 2.4</p> <p>Most functionality is also working under Python 3.1 and 3.2 (including modules using <a href="http://numpy.scipy.org/">NumPy</a>), and under <a href="http://pypy.org/">PyPy</a> (excluding our NumPy dependencies). We are now encouraging early adopters to help beta testing on these platforms.</p> <p>The installation setup.py now supports &lsquo;install_requires&rsquo; when setuptools is installed. This avoids the manual dialog when installing Biopython via easy_install or pip and numpy is not installed. It also allows user libraries that require Biopython to include it in their install_requires and get automatic installation of dependencies.</p> <h3 id="features">Features</h3> <p>New module <code>Bio.TogoWS</code> offers a wrapper for the <a href="http://togows.dbcls.jp/site/en/rest.html">TogoWS REST API</a>, a web service based in Japan offering access to KEGG, DDBJ, PDBj, CBRC plus access to some NCBI and EBI resources including PubMed, GenBank and UniProt. This is much easier to use than the NCBI Entrez API, but should be especially useful for Biopython users based in Asia.</p> <p>The <a href="http://eutils.ncbi.nlm.nih.gov/corehtml/query/static/efetch_help.html">NCBI Entrez Fetch</a> function <code>Bio.Entrez.efetch</code> has been updated to handle the NCBI&rsquo;s stricter handling of multiple ID arguments in EFetch 2.0 (released February 2012, see this <a href="http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000086.html">announcement</a>), however the NCBI have also changed the <code>retmode</code> default argument so <em>you</em> may need to make this explicit. e.g. add <code>retmode=&quot;text&quot;</code> to your EFetch calls (see this <a href="http://www.ncbi.nlm.nih.gov/mailman/pipermail/utilities-announce/2012-February/000085.html">announcement</a>).</p> <p>The position objects used in <code>Bio.SeqFeature</code> now act almost like integers, making dealing with fuzzy locations in EMBL/GenBank files much easier. Also the <code>SeqFeature</code>&rsquo;s strand and any database reference are now properties of the <code>FeatureLocation</code> object (a more logical placement), with proxy methods for backwards compatibility.</p> <p><code>Bio.Graphics.BasicChromosome</code> has been extended to allow simple sub-features to be drawn on chromosome segments, suitable to show the position of genes, SNPs or other loci.</p> <p><code>Bio.Graphics.GenomeDiagram</code> has been extended to allow <a href="http://news.open-bio.org/news/2012/03/cross-links-in-genomediagram/">cross-links between tracks</a>, and track specific start/end positions for showing regions. This can be used to imitate the output from the <a href="http://www.sanger.ac.uk/resources/software/act/">Artemis Comparison Tool (ACT)</a>. Also, a new attribute circle_core makes it easier to have an empty space in the middle of a circular diagram (see tutorial).</p> <p>Note <code>Bio.Graphics</code> requires the <a href="http://www.reportlab.com/software/opensource/">ReportLab library</a>.</p> <p><code>Bio.Align.Applications</code> now includes a wrapper for command line tool <a href="http://www.clustal.org/omega/">Clustal Omega</a> for protein multiple sequence alignment.</p> <p><code>Bio.AlignIO</code> now supports sequential <a href="http://evolution.genetics.washington.edu/phylip.html">PHYLIP</a> files (as well as interlaced PHYLIP files) as a separate format variant.</p> <p>Additionally there have been other minor bug fixes and more unit tests, and updates to the documentation including the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial</a> ( <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>).</p> <h3 id="contributors">Contributors</h3> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Andreas Wilm (first contribution)</li> <li>Alessio Papini (first contribution)</li> <li>Brad Chapman</li> <li>Brandon Invergo</li> <li>Connor McCoy</li> <li>Eric Talevich</li> <li>João Rodrigues</li> <li>Konrad Förstner (first contribution)</li> <li>Michiel de Hoon</li> <li>Matej Repič (first contribution)</li> <li>Leighton Pritchard</li> <li>Peter Cock</li> </ul>https://www.open-bio.org/2011/10/28/obf-annual-meeting-2011/Fri, 28 Oct 2011 20:54:15 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2011/10/28/obf-annual-meeting-2011/<p>The annual Board of Directors Meeting of the Open Bioinformatics Foundation will take place on November 8, 2011. As in previous years, it will be held by conference call, estimated to be about 2 hrs long.</p> <p>The meeting will on Tuesday 8 November 2011, at 11am EST, 8am PST, 16:00 UTC/GMT, 17:00 CET, or Wednesday 9 November 1am JST. Note for translating into other time zones that by then both Europe and the US have gone off DST.</p> <p>Note that this meeting, like all O|B|F Board meetings, is public; every member may call in at their leisure. Please see the <a href="https://www.open-bio.org/wiki/Minutes:2011_ConfCall">agenda of the meeting</a> (including dial-in information), see also the <a href="https://www.open-bio.org/wiki/Board">current board</a>.</p>https://www.open-bio.org/2011/10/28/chromosome-diagrams-in-biopython/Fri, 28 Oct 2011 15:44:10 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2011/10/28/chromosome-diagrams-in-biopython/<p>One of the new things coming in Biopython 1.59 is improved chromosome diagrams, something you may have seen <a href="http://twitter.com/#!/pjacock/status/121676973054496768">via Twitter</a>. I&rsquo;ve just been updating the Biopython Tutorial (current version <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">here</a>, <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>) to include an example drawing this:</p> <p><img src="https://github.com/biopython/biopython/raw/1574d8112914ea147f4e62c6b980543db1abdc7d/Doc/images/tRNA_chrom.png" alt="tRNA genes in Arabidopsis thaliana"></p> <p>Here&rsquo;s a <a href="https://github.com/biopython/biopython/raw/1574d8112914ea147f4e62c6b980543db1abdc7d/Doc/images/tRNA_chrom.pdf">PDF version</a> too. This example just parses the <em>Arabidopsis thaliana</em> GenBank files to get the chromosome lengths and the tRNA gene placements. There are so many tRNA on the forward strand of Chr I that their labels are forced to overlap. Here the figure just uses a different color for each chromosome, but you can color each feature individually.</p> <p>This kind of diagram is often used for showing the placement of SNPs or other loci of interest (e.g. disease or breeding markers).</p> <p>P.S. Biopython produces these and other graphics using <a href="http://www.reportlab.com/software/opensource/">ReportLab</a>, an open source Python library capable of outputting PDF, SVG, PNG, etc. Very handy.</p>https://www.open-bio.org/2011/08/18/biopython-1-58-released/Thu, 18 Aug 2011 17:06:47 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2011/08/18/biopython-1-58-released/<p>Source distributions and Windows installers for <strong>Biopython 1.58</strong> are available from the <a href="http://biopython.org/wiki/Download">downloads page</a> on the <a href="http://biopython.org">Biopython website</a> and from the <a href="http://pypi.python.org/pypi/biopython">Python Package Index (PyPI)</a>.</p> <p>A new interface and parsers for the <a href="http://abacus.gene.ucl.ac.uk/software/paml.html">PAML (Phylogenetic Analysis by Maximum Likelihood)</a> package of programs, supporting codeml, baseml and yn00 as well as a Python re-implementation of chi2 was added as the <code>Bio.Phylo.PAML</code> module.</p> <p>Bio.SeqIO now includes read and write support for the <a href="http://seqxml.org">SeqXML</a>, a simple XML format offering basic annotation support. See <a href="http://dx.doi.org/10.1093/bib/bbr025">Schmitt et al (2011) in Briefings in Bioinformatics</a>.</p> <p>Bio.SeqIO now includes read support for ABI files (&ldquo;Sanger&rdquo; capillary sequencing trace files, containing called sequence with PHRED qualities).</p> <p>The Bio.AlignIO &ldquo;fasta-m10&rdquo; parser was updated to cope with the marker lines as used in <a href="http://fasta.bioch.virginia.edu/fasta_www2/fasta_list2.shtml">Bill Pearson&rsquo;s FASTA</a> version 3.36, without this fix the parser would only return alignments for the first query sequence.</p> <p>The Bio.AlignIO &ldquo;phylip&rdquo; parser and writer now treat a dot/period in the sequence as an error, in line with the official PHYLIP specification. Older verions of our code didn&rsquo;t do anything special with this character. Also, support for &ldquo;phylip-relaxed&rdquo; has been added which allows longer record names as used in <a href="http://wwwkramer.in.tum.de/exelixis/software.html">RAxML</a> and <a href="http://www.atgc-montpellier.fr/phyml/">PHYML</a>.</p> <p>Of potential interest to anyone subclassing Biopython objects, any remaining &ldquo;old syle&rdquo; Python classes have been switched to &ldquo;new style&rdquo; classes. This allows things like defining properties.</p> <p>Bio.HMM&rsquo;s Viterbi algorithm now expects the initial probabilities explicitly.</p> <p>Many thanks to the Biopython developers and community for making this release possible, especially the following contributors:</p> <ul> <li>Aaron Gallagher (first contribution)</li> <li>Bartek Wilczynski</li> <li>Bogdan T. (first contribution)</li> <li>Brandon Invergo (first contribution)</li> <li>Connor McCoy (first contribution)</li> <li>David Cain (first contribution)</li> <li>Eric Talevich</li> <li>Fábio Madeira (first contribution)</li> <li>Hongbo Zhu</li> <li>Joao Rodrigues</li> <li>Michiel de Hoon</li> <li>Peter Cock</li> <li>Thomas Schmitt (first contribution)</li> <li>Tiago Antao</li> <li>Walter Gillett</li> <li>Wibowo Arindrarto (first contribution)</li> </ul>https://www.open-bio.org/2011/03/18/obf-gsoc-2011/Fri, 18 Mar 2011 21:44:22 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2011/03/18/obf-gsoc-2011/<p>Great news: Google announced today that the Open Bioinformatics Foundation (OBF) has been accepted as a mentoring organization for this summer&rsquo;s Google Summer of Code!</p> <p>GSoC is a Google-sponsored student internship program for open-source projects, open to students from around the world (not just US residents). Students are paid a $5000 USD stipend to work as a developer on an open-source project for the summer. For more on GSoC, see <a href="http://socghop.appspot.com/document/show/gsoc_program/google/gsoc2011/faqs">GSoC 2011 FAQ</a>.</p> <p>Student applications are due April 8, 2011 at 19:00 UTC. Students who are interested in participating should look at the <a href="http://open-bio.org/wiki/Google_Summer_of_Code">OBF&rsquo;s GSoC page</a>, which lists project ideas, and whom to contact about applying.</p> <p>For current developers on OBF projects, please consider volunteering to be a mentor if you have not already, and contribute project ideas. Just list your name and project ideas on the <a href="http://open-bio.org/wiki/Google_Summer_of_Code">OBF wiki page</a>, and on the relevant project&rsquo;s GSoC wiki page.</p> <p>Thanks to all who helped make OBF&rsquo;s application to GSoC a success, and let&rsquo;s have a great, productive summer of code!</p> <p>Rob Buels OBF GSoC 2011 Administrator</p>https://www.open-bio.org/2010/11/18/dropping-python24-support/Thu, 18 Nov 2010 15:09:15 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2010/11/18/dropping-python24-support/<p>This is a reminder that the forthcoming Biopython 1.56 release is <em>planned</em> to be our last release to support Python 2.4.</p> <p>Looking back, we supported Python 2.3 for about six years - it was released July 2003, and <a href="http://news.open-bio.org/news/2009/04/biopython-release-150/">Biopython 1.50</a> released in April 2009 was the last to support it. Similarly, Python 2.4 was released six years ago (November 2004).</p> <p>Dropping Python 2.4 support will allow use to assume standard library modules like the <a href="http://docs.python.org/library/xml.etree.elementtree.html">ElementTree XML parser</a> and <a href="http://docs.python.org/library/sqlite3.html">SQLite 3 support</a> will be available. There are also several <a href="http://docs.python.org/whatsnew/2.5.html">new language features in Python 2.5+</a> which will be useful, and it should make supporting Python 3 a little easier as well.</p> <p>Most operating systems which come with Python now ship with Python 2.5 or later, with the notable exception of <a href="http://centos.org">CentOS</a> where Python 2.4 is still used. Also, those of you running a Linux server may still be running an old but still supported OS - for example the <a href="http://www.ubuntu.com/">Ubuntu</a> 6.06 LTS (Dapper Drake) server edition is maintained until June 2011, and comes with Python 2.4.</p> <p>If you would be negatively affected by Biopython dropping support for Python 2.4, please let us know as soon as possible, ideally via the <a href="http://biopython.org/wiki/Mailing_lists">mailing list</a>.</p> <p>Thank you.</p>https://www.open-bio.org/2010/05/14/bioperl-has-moved-to-github/Fri, 14 May 2010 04:18:33 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2010/05/14/bioperl-has-moved-to-github/<p>BioPerl has migrated to <a href="http://git-scm.com/">git</a> and <a href="http://github.com/bioperl">GitHub</a>!  We have also set up a mirror set of several key repositories at the great public git hosting site <a href="http://repo.or.cz/w">repo.or.cz</a>.</p> <p>If you are a current BioPerl developer (had a previous account for direct access to our prior Subversion repository), please sign up for a GitHub account and let us know your user ID.  Also, add the extra email <a href="https://www.open-bio.org/wp-content/uploads/2010/05/generic.jpg"><img src="https://www.open-bio.org/wp-content/uploads/2010/05/generic.jpg" alt=""></a> (where &lsquo;DEVNAME&rsquo; is your <strong>original Subversion account ID</strong>).  This should map any previous commits from the older Subversion and CVS repository to your new GitHub account.</p> <p>The following are ways everyone can download the latest code.</p> <h2 id="using-git">Using git</h2> <p>Note you can replace &lsquo;bioperl-live.git&rsquo; with any of the repository names (bioperl-db, bioperl-run, etc).  For BioPerl developers (GitHub collaborators) you have a choice of SSH or HTTP:</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span> git clone git@github.com:bioperl/bioperl-live.git </span></span></code></pre></div><div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span> git clone https://bioperl@github.com/bioperl/bioperl-live.git </span></span></code></pre></div><p>The open read-only link (for everyone):</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span> git clone git://github.com/bioperl/bioperl-live.git </span></span></code></pre></div><p>or using the mirror site:</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span> git clone git://repo.or.cz/bioperl-live.git </span></span></code></pre></div><h2 id="using-svn-read-only">Using SVN (read-only)</h2> <p>We will also support read-only access to GitHub with Subversion.  We may allow write support at some later point.  To use svn:</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span> svn checkout http://svn.github.com/bioperl/bioperl-live.git </span></span></code></pre></div><h2 id="direct-downloads">Direct downloads</h2> <p>Tagged releases can be found here:</p> <p><a href="http://github.com/bioperl/bioperl-live/downloads">http://github.com/bioperl/bioperl-live/downloads</a></p> <p>The latest source code here:</p> <p><a href="http://github.com/bioperl/bioperl-live/archives/master">http://github.com/bioperl/bioperl-live/archives/master</a></p> <h2 id="forking-bioperl-and-pull-requests"><strong>Forking BioPerl and Pull Requests</strong></h2> <p>We intend on using git and GitHub to their fullest.  With that in mind, we encourage users to <a href="http://help.github.com/forking/">fork</a> BioPerl code, make changes, commit them to your forked repository, and submit <a href="http://github.com/guides/pull-requests">pull requests</a>.</p> <h2 id="documentation">Documentation</h2> <p>We&rsquo;re also in the process of updating our local developer documents for help with those who haven&rsquo;t used git before.  In particular, we have a <a href="http://www.bioperl.org/wiki/Using_Git">Using Git</a> page, and have added <a href="http://www.bioperl.org/wiki/Tracking_Git_commits">RSS feeds</a> for our repository commits.</p> <p>Enjoy!</p> <p>chris</p> <p><strong>Update:</strong> SVN version fixed, thanks to DaveMessina++ for pointing it out.</p>https://www.open-bio.org/2010/04/30/illumina-q2-trim-fastq/Fri, 30 Apr 2010 07:49:45 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2010/04/30/illumina-q2-trim-fastq/<p>In another quirk to the <a href="http://news.open-bio.org/news/2009/12/nar-fastq-format/">FASTQ story</a>, recent Illumina FASTQ files don&rsquo;t actually use the full range of PHRED scores - and a score of 2 has a special meaning, <em>The Read Segment Quality Control Indicator</em> (RSQCI, encoded as &lsquo;B&rsquo;).</p> <p>Hats off to <em>Dr Torsten Seemann</em> for raising awareness of this issue in <a href="http://seqanswers.com/forums/showpost.php?p=17491&amp;postcount=3">his post on the seqanswers.com forum</a>, referring to a presentation by <em>Tobias Mann</em> of Illumina which says:</p> <blockquote> <p><em>The Read Segment Quality Control Indicator:</em></p> <p><em>- At the ends of some reads, quality scores are unreliable. Illumina has an algorithm for identifying these unreliable runs of quality scores, and we use a special indicator to flag these portions of reads</em></p> <p><em>- A quality score of 2, encoded as a &ldquo;B&rdquo;, is used as a special indicator. A quality score of 2 does not imply a specific error rate, but rather implies that the marked region of the read should not be used for downstream analysis.</em></p> <p><em>- Some reads will end with a run of B (or Q2) basecalls, but there will never  be an isolated Q2 basecall.</em></p> </blockquote> <p>So, armed with this knowledge, you might want to apply a simple trimming criteria to any Illumina FASTQ files - remove anything after and including a PHRED quality score of 2 (encoded as ASCII &lsquo;B&rsquo;).</p> <p>We could do this with the rich object orientated <code>SeqRecord</code> based API in Biopython, but when <a href="http://news.open-bio.org/news/2009/09/biopython-fast-fastq/">dealing with massive FASTQ files</a> this overhead matters. Instead we&rsquo;ll stick with plain Python strings:</p> <p><code>from Bio.SeqIO.QualityIO import FastqGeneralIterator handle = open(&quot;B_trimmed.fastq&quot;, &quot;w&quot;) min_length = 10 for title, seq, qual in FastqGeneralIterator(open(&quot;untrimmed.fastq&quot;)) : #Find the location of the first &quot;B&quot; (PHRED quality 2) trim = qual.find(&quot;B&quot;) if trim == -1: #No need to trim handle.write(&quot;@%sn%sn+n%sn&quot; % (title, seq, qual)) elif trim &gt;= min_length: #Take everything up to the first B handle.write(&quot;@%sn%sn+n%sn&quot; % (title, seq[:trim], qual[:trim])) handle.close()</code></p> <p>In practice the above can trim too much - you can still get isolated &ldquo;B&rdquo; characters in the middle of a read, where it is just a low quality score. Instead, we can trim any trailing &ldquo;B&rdquo; characters - which will do the same thing on RSQCI based FASTQ files where the &ldquo;B&rdquo; should only appear at the end:</p> <p><code>from Bio.SeqIO.QualityIO import FastqGeneralIterator handle = open(&quot;B_trimmed.fastq&quot;, &quot;w&quot;) min_length = 10 for title, seq, qual in FastqGeneralIterator(open(&quot;untrimmed.fastq&quot;)) : qual = qual.rstrip(&quot;B&quot;) #Remove any trailing B characters length = len(qual) if length &gt;= min_length: seq = seq[:length] #trim to match handle.write(&quot;@%sn%sn+n%sn&quot; % (title, seq, qual)) handle.close()</code></p> <p>You could easily modify this example to read from stdin and write to stdout (see this <a href="http://www.biopython.org/wiki/Reading_from_unix_pipes">cookbook example</a>), or take filenames as command line arguments to turn this into a general purpose &ldquo;FASTQ B-trimming script&rdquo;.</p>https://www.open-bio.org/2010/04/27/partial-seq-files-biopython/Tue, 27 Apr 2010 13:03:04 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2010/04/27/partial-seq-files-biopython/<p>This is another blog post to highlight one of the neat tricks you&rsquo;ll be able to do with Biopython 1.54 (which you can help test with the <a href="http://news.open-bio.org/news/2010/04/biopython-1-54-beta-released/">Biopython 1.54 beta</a> release).</p> <p>It is often useful to be able to extract a few records from a larger sequence file - for example, some sequences of interest from a full UniProt or GenBank dump. One obvious way to try to do this is to parse the file into an object representation (i.e. <code>SeqRecord</code> objects using <code>Bio.SeqIO.parse(...)</code>), filter to pick out the entries you want, and then write them back to disk (using <code>Bio.SeqIO.write(...)</code>). However, for complex file formats like GenBank this can be lossy ( <code>Bio.SeqIO</code> does not support a 100% identical round trip), and Biopython don&rsquo;t currently support writing out the SwissProt plain text format used by UniProt. So, that approach won&rsquo;t work.</p> <p><a href="http://news.open-bio.org/news/2009/09/biopython-release-152/">Biopython 1.52</a> introduced a new <a href="http://news.open-bio.org/news/2009/09/biopython-seqio-index/">indexing function</a>, <code>Bio.SeqIO.index(...)</code>, which allows a large multi-sequence file to be treated like a Python dictionary - parsing requested records on request. This has been enhanced for Biopython 1.54 with a method <code>get_raw(...)</code> to extract the raw for a record as a string.</p> <p>How is this useful? Well, take your large (UniProt) file, index it, then extract the records you want and write them to your output file unmodified:</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>from Bio import SeqIO </span></span><span style="display:flex;"><span>uniprot = SeqIO.index(&#34;uniprot_sprot.dat&#34;, &#34;swiss&#34;) </span></span><span style="display:flex;"><span>handle = open(&#34;selected.dat&#34;, &#34;w&#34;) </span></span><span style="display:flex;"><span>for acc in [&#34;P33487&#34;, &#34;P19801&#34;, &#34;P13689&#34;, &#34;Q8JZQ5&#34;, &#34;Q9TRC7&#34;]: </span></span><span style="display:flex;"><span> handle.write(uniprot.get_raw(acc)) </span></span><span style="display:flex;"><span>handle.close() </span></span></code></pre></div><p>Another neat use of this functionality would be to sort entries in a sequential file format, and there is an example of that in the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial</a> ( <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>).</p>https://www.open-bio.org/2010/04/05/biopython-seqio-and-alignio-easier/Mon, 05 Apr 2010 16:37:11 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2010/04/05/biopython-seqio-and-alignio-easier/<p>One of the small changes coming in Biopython 1.54 (which you can try out already using the <a href="http://news.open-bio.org/news/2010/04/biopython-1-54-beta-released/">Biopython 1.54 beta</a>) is to <a href="http://www.biopython.org/wiki/SeqIO">Bio.SeqIO</a> and <a href="http://www.biopython.org/wiki/AlignIO">Bio.AlignIO</a>. Previously the input and output functions had required file <em>handles</em>, but they will now also accept <em>filenames</em>.</p> <p>This is a case of <em>practicality beats purity</em> (to quote <a href="http://www.python.org/dev/peps/pep-0020/">the Zen of Python</a>), and is particularly handy when doing very short scripts or working at the Python prompt.</p> <p>For example, filtering a FASTA file to take only entries with a minimum length of 100 can be done like this (with handles):</p> <p><code>from Bio import SeqIO in_handle = open(&quot;example.fasta&quot;, &quot;rU&quot;) out_handle = open(&quot;long.fasta&quot;, &quot;w&quot;) records = (rec for rec in SeqIO.parse(in_handle, &quot;fasta&quot;) if len(rec)&gt;100) SeqIO.write(records, out_handle, &quot;fasta&quot;) in_handle.close() out_handle.close()</code></p> <p>Using filenames it becomes much more concise - just three lines:</p> <p><code>from Bio import SeqIO records = (rec for rec in SeqIO.parse(&quot;example.fasta&quot;, &quot;fasta&quot;) if len(rec)&gt;100) SeqIO.write(records, &quot;long.fasta&quot;, &quot;fasta&quot;)</code></p> <p>This also means Python and Biopython beginners can postpone learning about file handles a little longer, although that may not be an entirely good thing ;)</p>https://www.open-bio.org/2009/12/17/nar-fastq-format/Thu, 17 Dec 2009 16:28:55 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2009/12/17/nar-fastq-format/<p>I&rsquo;m delighted to announce an open access publication in <em>Nucleic Acids Research</em> describing the FASTQ file format based on the conventions agreed by the OBF projects:</p> <blockquote> <p><a href="http://dx.doi.org/10.1093/nar/gkp1137">The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants</a> Peter J. A. Cock ( <a href="http://www.biopython.org">Biopython</a>), Christopher J. Fields ( <a href="http://www.bioperl.org">BioPerl</a>), Naohisa Goto ( <a href="http://www.bioruby.org">BioRuby</a>), Michael L. Heuer ( <a href="http://www.biojava.org">BioJava</a>) and Peter M. Rice ( <a href="http://emboss.sourceforge.net/">EMBOSS</a>). Nucleic Acids Research, <a href="http://dx.doi.org/10.1093/nar/gkp1137">doi:10.1093/nar/gkp1137</a></p> </blockquote> <p>This will hopefully serve as a reference describing the original standard Sanger FASTQ, and the two variants from Solexa/Illumina, and how to inter-convert between them.</p>https://www.open-bio.org/2009/12/14/interleaving-paired-fastq-files-with-biopython/Mon, 14 Dec 2009 14:03:41 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2009/12/14/interleaving-paired-fastq-files-with-biopython/<p>This post is about paired end data (FASTA or FASTQ) and manipulating it with Biopython&rsquo;s <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO</a> module (see also <a href="http://news.open-bio.org/news/2009/09/biopython-convert-function/">FASTQ conversions</a> &amp; <a href="http://news.open-bio.org/news/2009/09/biopython-fast-fastq/">speeding up FASTQ</a>).</p> <p>There are two main ways of presenting paired end data in FASTA or FASTQ files:</p> <ul> <li>Paired files, with matching entries for the forward and reverse reads (probably the norm with Illumina data)</li> <li>Single files, with alternating entries for the forward and reverse reads (used by Velvet)</li> </ul> <p>Converting between these two is a relatively common operation, and is normally pretty easy. There was a <a href="http://lists.open-bio.org/pipermail/biopython/2009-September/005584.html">short example</a> of how you might do this in Biopython on a recent (September 2009) Velvet users/Biopython mailing list discussion. That script didn&rsquo;t check the record IDs matched up (but neither does the Perl script shuffleSequences_fastq.pl included with Velvet for this task).</p> <p>It would be safer to check the record IDs do match. However, there are several different naming schemes for reads, most typically suffixes of <code>/1</code> and <code>/2</code>, but also things like <code>.f</code> and <code>.r</code> get used. In the case of FASTQ files from the NCBI SRA, the reads have no suffixes, so to feed those into Velvet you may want to check they are equal and then add a suffix as shown below.</p> <p><code> </code></p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-gdscript3" data-lang="gdscript3"><span style="display:flex;"><span><span style="color:#75715e">#This Python script requires Biopython 1.51 or later</span> </span></span><span style="display:flex;"><span>from Bio import SeqIO </span></span><span style="display:flex;"><span>import itertools </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span><span style="color:#75715e">#Setup variables (could parse command line args instead)</span> </span></span><span style="display:flex;"><span>file_f <span style="color:#f92672">=</span> <span style="color:#e6db74">&#34;SRR001666_1.fastq&#34;</span> </span></span><span style="display:flex;"><span>file_r <span style="color:#f92672">=</span> <span style="color:#e6db74">&#34;SRR001666_2.fastq&#34;</span> </span></span><span style="display:flex;"><span>file_out <span style="color:#f92672">=</span> <span style="color:#e6db74">&#34;SRR001666_interleaved.fastq&#34;</span> </span></span><span style="display:flex;"><span>format <span style="color:#f92672">=</span> <span style="color:#e6db74">&#34;fastq&#34;</span> <span style="color:#75715e">#or &#34;fastq-illumina&#34;, or &#34;fasta&#34;, or ...</span> </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span><span style="color:#66d9ef">def</span> <span style="color:#a6e22e">interleave</span>(iter1, iter2) : </span></span><span style="display:flex;"><span> <span style="color:#66d9ef">for</span> (forward, reverse) <span style="color:#f92672">in</span> itertools<span style="color:#f92672">.</span>izip(iter1,iter2): </span></span><span style="display:flex;"><span> assert forward<span style="color:#f92672">.</span>id <span style="color:#f92672">==</span> reverse<span style="color:#f92672">.</span>id </span></span><span style="display:flex;"><span> forward<span style="color:#f92672">.</span>id <span style="color:#f92672">+=</span> <span style="color:#e6db74">&#34;/1&#34;</span> </span></span><span style="display:flex;"><span> reverse<span style="color:#f92672">.</span>id <span style="color:#f92672">+=</span> <span style="color:#e6db74">&#34;/2&#34;</span> </span></span><span style="display:flex;"><span> yield forward </span></span><span style="display:flex;"><span> yield reverse </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>records_f <span style="color:#f92672">=</span> SeqIO<span style="color:#f92672">.</span>parse(open(file_f,<span style="color:#e6db74">&#34;rU&#34;</span>), format) </span></span><span style="display:flex;"><span>records_r <span style="color:#f92672">=</span> SeqIO<span style="color:#f92672">.</span>parse(open(file_r,<span style="color:#e6db74">&#34;rU&#34;</span>), format) </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>handle <span style="color:#f92672">=</span> open(file_out, <span style="color:#e6db74">&#34;w&#34;</span>) </span></span><span style="display:flex;"><span>count <span style="color:#f92672">=</span> SeqIO<span style="color:#f92672">.</span>write(interleave(records_f, records_r), handle, format) </span></span><span style="display:flex;"><span>handle<span style="color:#f92672">.</span>close() </span></span><span style="display:flex;"><span>print <span style="color:#e6db74">&#34;</span><span style="color:#e6db74">%i</span><span style="color:#e6db74"> records written to </span><span style="color:#e6db74">%s</span><span style="color:#e6db74">&#34;</span> <span style="color:#f92672">%</span> (count, file_out) </span></span></code></pre></div><p>This example uses the <a href="http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?cmd=viewer&amp;m=data&amp;s=viewer&amp;run=SRR001666">SRR001666</a> files from the <a href="ftp://ftp.ncbi.nlm.nih.gov/sra/static/SRX000/SRX000430/">NCBI SRA FTP site</a>.</p> <p>Now that works fine, and just by changing the filenames and the format name this could be used on FASTA data (or another supported file format). The bad news is it took 14 minutes to produce a 2GB FASTQ. However, going a little more low-level <a href="http://news.open-bio.org/news/2009/09/biopython-fast-fastq/">as discussed before</a> can really pay off. This FASTQ-only version takes just 2 minutes:</p> <p><code> </code></p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-gdscript3" data-lang="gdscript3"><span style="display:flex;"><span><span style="color:#75715e">#This Python script requires Biopython 1.51 or later</span> </span></span><span style="display:flex;"><span>from Bio<span style="color:#f92672">.</span>SeqIO<span style="color:#f92672">.</span>QualityIO import FastqGeneralIterator </span></span><span style="display:flex;"><span>import itertools </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span><span style="color:#75715e">#Setup variables (could parse command line args instead)</span> </span></span><span style="display:flex;"><span>file_f <span style="color:#f92672">=</span> <span style="color:#e6db74">&#34;SRR001666_1.fastq&#34;</span> </span></span><span style="display:flex;"><span>file_r <span style="color:#f92672">=</span> <span style="color:#e6db74">&#34;SRR001666_2.fastq&#34;</span> </span></span><span style="display:flex;"><span>file_out <span style="color:#f92672">=</span> <span style="color:#e6db74">&#34;SRR001666_interleaved.fastq&#34;</span> </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>handle <span style="color:#f92672">=</span> open(file_out, <span style="color:#e6db74">&#34;w&#34;</span>) </span></span><span style="display:flex;"><span>count <span style="color:#f92672">=</span> <span style="color:#ae81ff">0</span> </span></span><span style="display:flex;"><span> </span></span><span style="display:flex;"><span>f_iter <span style="color:#f92672">=</span> FastqGeneralIterator(open(file_f,<span style="color:#e6db74">&#34;rU&#34;</span>)) </span></span><span style="display:flex;"><span>r_iter <span style="color:#f92672">=</span> FastqGeneralIterator(open(file_r,<span style="color:#e6db74">&#34;rU&#34;</span>)) </span></span><span style="display:flex;"><span><span style="color:#66d9ef">for</span> (f_id, f_seq, f_q), (r_id, r_seq, r_q) </span></span><span style="display:flex;"><span><span style="color:#f92672">in</span> itertools<span style="color:#f92672">.</span>izip(f_iter,r_iter): </span></span><span style="display:flex;"><span> assert f_id <span style="color:#f92672">==</span> r_id </span></span><span style="display:flex;"><span> count <span style="color:#f92672">+=</span> <span style="color:#ae81ff">2</span> </span></span><span style="display:flex;"><span> <span style="color:#75715e">#Write out both reads with &#34;/1&#34; and &#34;/2&#34; suffix on ID</span> </span></span><span style="display:flex;"><span> handle<span style="color:#f92672">.</span>write(<span style="color:#e6db74">&#34;@</span><span style="color:#e6db74">%s</span><span style="color:#e6db74">/1n</span><span style="color:#e6db74">%s</span><span style="color:#e6db74">n+n</span><span style="color:#e6db74">%s</span><span style="color:#e6db74">n@</span><span style="color:#e6db74">%s</span><span style="color:#e6db74">/2n</span><span style="color:#e6db74">%s</span><span style="color:#e6db74">n+n</span><span style="color:#e6db74">%s</span><span style="color:#e6db74">n&#34;</span> </span></span><span style="display:flex;"><span> <span style="color:#f92672">%</span> (f_id, f_seq, f_q, r_id, r_seq, r_q)) </span></span><span style="display:flex;"><span>handle<span style="color:#f92672">.</span>close() </span></span><span style="display:flex;"><span>print <span style="color:#e6db74">&#34;</span><span style="color:#e6db74">%i</span><span style="color:#e6db74"> records written to </span><span style="color:#e6db74">%s</span><span style="color:#e6db74">&#34;</span> <span style="color:#f92672">%</span> (count, file_out) </span></span></code></pre></div><p>You can make this a little faster still by missing out most of the validation done by the Biopython FASTQ parser - but personally I wouldn&rsquo;t take that risk. I&rsquo;d much rather know about any errors in the data.</p> <p>Peter</p> <p>P.S.</p> <p>Things get more interesting if you want to do quality filtering or trimming. If only one of a pair passes the quality assurance step, then you may want to keep it and treat it as an unpaired read. To give such cleaned up data to Velvet, you would need one file of alternating paired end reads, and a separate file of the orphaned effectively unpaired reads. That deserves another post going into more detail&hellip;</p>https://www.open-bio.org/2009/09/25/biopython-fast-fastq/Fri, 25 Sep 2009 11:49:53 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2009/09/25/biopython-fast-fastq/<p><a href="http://news.open-bio.org/news/2009/08/biopython-1-51-released/">Biopython 1.51</a> onward includes support for Sanger, Solexa and Illumina 1.3+ FASTQ files in <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO</a>, which allows a lot of neat tricks very concisely. For example, the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">tutorial</a> ( <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>) has examples finding and removing primer or adaptor sequences.</p> <p>However, because the Bio.SeqIO interface revolves around <a href="http://biopython.org/wiki/SeqRecord">SeqRecord objects</a> there is often a speed penalty. For example for <a href="http://en.wikipedia.org/wiki/FASTQ_format">FASTQ files</a>, the quality string gets turned into a list of integers on parsing, and then re-encoded back to ASCII on writing.</p> <p>The new <a href="http://news.open-bio.org/news/2009/09/biopython-convert-function/">Bio.SeqIO.convert(&hellip;)</a> function in <a href="http://news.open-bio.org/news/2009/09/biopython-release-152/">Biopython 1.52</a> onwards makes converting from FASTQ to FASTA, or between the FASTQ variants about five times faster. It can do this because it doesn&rsquo;t bother with creating any objects - it just uses Python strings.</p> <p>You can use the same approach in your own scripts. For example, suppose you have a Solexa FASTQ file where you want to trim all the reads, taking just the first 21 bases (say). Why might you want to do this? Well, in Solexa/Illumina there is a general decline in read quality along the sequence, so it can make sense to trim, and some algorithms like to have all the input reads the same length. Here is how I would write this using the standard Bio.SeqIO functions:</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>from Bio import SeqIO </span></span><span style="display:flex;"><span>records = (rec[:21] for rec in SeqIO.parse(open(&#34;untrimmed.fastq&#34;), &#34;fastq-solexa&#34;)) </span></span><span style="display:flex;"><span>handle = open(&#34;trimmed21.fastq&#34;, &#34;w&#34;) </span></span><span style="display:flex;"><span>count = SeqIO.write(records, handle, &#34;fastq-solexa&#34;) </span></span><span style="display:flex;"><span>handle.close() </span></span><span style="display:flex;"><span>print &#34;Trimmed %i FASTQ records&#34; % count </span></span></code></pre></div><p>This works, and is very simple and general. The same template can be used on any file formats supported by <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO</a>. However, it might be a bit slow for large next generation sequence files.</p> <p>Instead, we can get a little more low level - and work directly with strings. This requires you to know more about the details of the FASTQ file format. Parsing FASTQ files is surprising complicated (with nasty things like line wrapping technically allowed), so we&rsquo;ll still get Biopython to do that bit - but not bother with constructing SeqRecord objects and decoding the FASTQ quality strings. On the other hand, doing the FASTQ output explicitly isn&rsquo;t actually too bad once you know how things work:</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>from Bio.SeqIO.QualityIO import FastqGeneralIterator </span></span><span style="display:flex;"><span>trim = 21 </span></span><span style="display:flex;"><span>handle = open(&#34;trimmed21.fastq&#34;, &#34;w&#34;) </span></span><span style="display:flex;"><span>for title, seq, qual in FastqGeneralIterator(open(&#34;untrimmed.fastq&#34;)) : </span></span><span style="display:flex;"><span>    handle.write(&#34;@%sn%sn+n%sn&#34; % (title, seq[:trim], qual[:trim])) </span></span><span style="display:flex;"><span>handle.close() </span></span></code></pre></div><p>Again, the solution is a very short script - but this time it is much less flexible, and not nearly as clear what is going on. On the bright side, it is many times faster. Deciding on this trade-off is down to you, but I hope this blog post has highlighted the potential usefulness of the FastqGeneralIterator function in Bio.SeqIO.QualityIO, which you might otherwise have overlooked. To find out more, please read the built in documentation (also available <a href="http://biopython.org/DIST/docs/api/Bio.SeqIO.QualityIO-module.html#FastqGeneralIterator" title="Documentation for Bio.SeqIO.QualityIO function FastqGeneralIterator">online</a>):</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>from Bio.SeqIO.QualityIO import FastqGeneralIterator </span></span><span style="display:flex;"><span>&gt;&gt;&gt; help(FastqGeneralIterator) </span></span><span style="display:flex;"><span>... </span></span></code></pre></div><p>Please sign up to the <a href="http://biopython.org/wiki/Mailing_lists">Biopython mailing list</a> if you want to discuss this topic further.</p> <p>Peter</p> <p><em>Update</em>: A similar parser for FASTA files for looping over the records as strings was added in Biopython 1.61,</p> <div class="highlight"><pre tabindex="0" style="color:#f8f8f2;background-color:#272822;-moz-tab-size:4;-o-tab-size:4;tab-size:4;-webkit-text-size-adjust:none;"><code class="language-fallback" data-lang="fallback"><span style="display:flex;"><span>&gt;&gt;&gt; from Bio.SeqIO.FastaIO import SimpleFastaParser </span></span><span style="display:flex;"><span>&gt;&gt;&gt; help(SimpleFastaParser) </span></span><span style="display:flex;"><span>... </span></span></code></pre></div>https://www.open-bio.org/2009/09/24/biopython-cvs-to-git-migration/Thu, 24 Sep 2009 13:00:04 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2009/09/24/biopython-cvs-to-git-migration/<p>The release of <a href="http://news.open-bio.org/news/2009/09/biopython-release-152/">Biopython 1.52</a> earlier this week marked the end of an era, it was our last release using CVS for source code control.</p> <p>As of now, Biopython is using a <a href="http://github.com/biopython/biopython" title="Biopython on github">git repository</a>, hosted on <a href="http://github.com">github.com</a> who kindly provide git hosting for open source projects free of charge. The <a href="http://bioruby.org">BioRuby project</a> have been <a href="http://github.com/bioruby/bioruby" title="BioRuby on github">using github</a> for some time, so we are in good company.</p> <p>Our existing OBF hosted CVS repository will be maintained in the short to medium term as a backup, but will not be updated.</p> <p>Although many people have been involved in this move, we&rsquo;d like to thank Bartek Wilczynski in particular for handling the CVS to git conversion, and the mirroring our CVS updates to git during the transition period. In the next few weeks hopefully we&rsquo;ll get our <a href="http://biopython.org/wiki/GitUsage">git usage wiki pages</a> perfected, as we start using git for real.</p>https://www.open-bio.org/2009/09/22/biopython-convert-function/Tue, 22 Sep 2009 10:24:57 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2009/09/22/biopython-convert-function/<p>As per <a href="http://news.open-bio.org/news/2009/09/biopython-seqio-index/" title="Indexing sequence files with Biopython">Peter&rsquo;s recent post</a> we are using this space to show of a couple of the new features in <a href="http://biopython.org">Biopython</a> 1.52 before it is released. In this post we&rsquo;ll look at the new <strong>convert()</strong> function that both <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO</a> and <a href="http://biopython.org/wiki/AlignIO">Bio.AlignIO</a> will get in Biopython 1.52.</p> <p>No one has ever complained that bioinformatics just doesn&rsquo;t have enough file formats - you probably frequently find yourself converting sequence files to suit particular applications with <strong>Bio.SeqIO</strong>. At the moment this is usually a two step process, something like this:</p> <p>`&raquo;&gt; records = SeqIO.parse(in_handle &ldquo;genbank&rdquo;)</p> <blockquote> <blockquote> <blockquote> <p>SeqIO.write(records, out_handle, &ldquo;fasta&rdquo;)`</p> </blockquote> </blockquote> </blockquote> <p>As of Biopython 1.52, you&rsquo;ll be able to achieve the same result in a single step:</p> <p><code>&gt;&gt;&gt; SeqIO.convert(in_handle, &quot;genbank&quot;, out_handle, &quot;fasta&quot;)</code></p> <p>In fact, it&rsquo;s even easier than that because the convert function will accept filename strings as well as file handles for both input and output.</p> <p>Adding the convert function to <strong>Bio.SeqIO</strong> and <strong>Bio.AlignIO</strong> will make your scripts more readable and might even save you a couple of lines of code, but perhaps more importantly it allows for the conversion process to be optimized for the two formats being used. In most cases the same old parse and write functions are called internally, however some key conversions are much faster&hellip;</p> <p>In the above example we are moving from a GenBank file, which probably includes multiple features for each sequence, to a FASTA file, which doesn&rsquo;t include features. If we used the two step process above we&rsquo;d be spending time reading each sequence&rsquo;s features into memory just to skip them when they get passed to the write function. <strong>Bio.SeqIO.convert()</strong> knows that the sequences in the input file are destined to be written to a FASTA file so it can skip over the features and save a bit of time in doing the conversion.</p> <p>Obviously, any optimization is most important when its used on very large files, like those produced in next generation sequencing projects. For example, when converting between each of the FASTQ file formats variants with the &ldquo;SeqIO two step&rdquo; a significant amount of time is taken creating <a href="http://biopython.org/wiki/SeqRecord">SeqRecord objects</a> for each record in the input file and decoding the quality scores into numbers. However, none of the attributes or methods of the SeqRecord object are required to do the conversion. For this reason <strong>Bio.SeqIO.convert()</strong> deals with each record as simple strings. This makes it about five times faster - on a par with converters written in C.</p> <p>The Biopython 1.52 edition of the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial &amp; Cookbook</a> ( <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>) will cover these new convert functions in more detail.</p>https://www.open-bio.org/2009/09/21/biopython-seqio-index/Mon, 21 Sep 2009 17:37:12 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2009/09/21/biopython-seqio-index/<p>The forthcoming release of <a href="http://news.open-bio.org/news/2009/09/biopython-release-152/">Biopython 1.52</a> will include a couple of nice improvements to the <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO module</a>, and here we&rsquo;re going to introduce the new <strong>index</strong> function. This will of course be covered in the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial &amp; Cookbook</a> ( <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>) once this code is released.</p> <p>Suppose you have a <em>large</em> sequence file with many many individual sequences in it. This could be next generation sequence data for example, maybe a FASTQ, FASTA or QUAL file. Or, it might be a big annotation rich file, such as the whole of UniProt, or a chunk of GenBank.</p> <p>The <strong>Bio.SeqIO.parse(&hellip;)</strong> function lets you iterate over all the records in a file, one by one. This allows you to process each sequence in turn, keeping only one in memory at a time. This approach is <em>very</em> valuable for dealing with big files.</p> <p>However, sometimes you can&rsquo;t just loop over the records in the order found in the file. You may <em>require</em> random access. In Python, the natural API here is a dictionary - for example looking up the records via their ID string. This is how the existing <strong>Bio.SeqIO.to_dict(&hellip;)</strong> function works. It is just a helper function to build an <em>in memory</em> dictionary of a collection of SeqRecord objects. However, because everything is kept in memory (RAM), this only works on small or medium sized files. :(</p> <p>So, what should you do when you have a very large file, and it is no longer possible to load everything into memory at once? Well, you might consider using a <a href="http://biosql.org">BioSQL</a> database - this is probably quite a sensible option for something like GenBank data. However, for next generation sequencing data this is probably overkill. This is where the new <strong>Bio.SeqIO.index(&hellip;)</strong> function comes in. It behaves like a Python dictionary, but doesn&rsquo;t keep everything in memory at once!</p> <p>What <strong>Bio.SeqIO.index(&hellip;)</strong> does is first quickly scan the file looking for the position of each new record, and records this information against the record ID string. This still requires a reasonable amount of memory, but works fine even for millions of entries in a file. Then, when you ask for a particular record, it jumps to the relevant part of the file, and then parses the data into a SeqRecord.</p> <p>For example, consider the FASTQ file SRR014849.fastq (available <a href="ftp://ftp.ncbi.nlm.nih.gov/sra/static/SRX003/SRX003639/SRR014849.fastq.gz">compressed at the NCBI</a>). The <strong>Bio.SeqIO.index(&hellip;)</strong> function takes a minimum of two arguments, the filename and the file format:</p> <p>`</p> <blockquote> <blockquote> <blockquote> <p>from Bio import SeqIO data = SeqIO.index(&ldquo;SRR014849.fastq&rdquo;, &ldquo;fastq&rdquo;) len(data) 94696 data.keys()[:3] [&lsquo;SRR014849.80961&rsquo;, &lsquo;SRR014849.80960&rsquo;, &lsquo;SRR014849.80963&rsquo;] print data[&ldquo;SRR014849.290838&rdquo;].seq TGAGAATTTTTATTTTCAAGGGTTGGAACCGAAGGGTTTGAATTCAAACCCTTTCGGTTCCAACCCGACAAGTCATCGATGTTG print data[&ldquo;SRR014849.290838&rdquo;].letter_annotations[&ldquo;phred_quality&rdquo;] [20, 18, 24, 25, 33, 26, 37, 33, 22, 11, 1, 22, 37, 33, 22, 10, 25, 31, 26, 36, 32, 16, 33, 26, 31, 25, 33, 25, 31, 25, 22, 33, 26, 35, 30, 12, 35, 31, 17, 19, 30, 20, 33, 26, 27, 31, 27, 6, 36, 32, 15, 33, 29, 10, 27, 32, 24, 30, 25, 30, 20, 24, 13, 35, 31, 13, 27, 26, 28, 32, 24, 28, 28, 27, 22, 22, 26, 28, 26, 24, 27, 30, 22, 27]`</p> </blockquote> </blockquote> </blockquote> <p>In this case the FASTQ file is only 24MB (so the example is easy to try at home), but the same approach works just as well on a 1GB FASTQ file :)</p> <p>This will be covered in more detail by the new edition of the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial &amp; Cookbook</a>, and once you have Biopython 1.52 or later installed don&rsquo;t forget about the built in help:</p> <p>`&raquo;&gt; from Bio import SeqIO</p> <blockquote> <blockquote> <blockquote> <p>help(SeqIO.index) &hellip; `</p> </blockquote> </blockquote> </blockquote> <p>Biopython 1.52 will index most of the file formats that can already be parsed with the SeqIO library - but not any multiple alignment formats. There is a table on the <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO wiki page</a>.</p> <p>Enjoy!</p> <p>Peter</p> <p>P.S. Note that random access to all the records in a sequence file isn&rsquo;t the only potential benefit of using <strong>Bio.SeqIO.index(&hellip;)</strong>. Suppose you are only interested in a few entries in a large file. You could use a for loop with <strong>Bio.SeqIO.parse(&hellip;)</strong>, but this will mean every single record gets parsed and turned into a SeqRecord. If instead you used <strong>Bio.SeqIO.index(&hellip;)</strong> then only the few records you care about get parsed and turned into SeqRecord objects. This can save a lot of time, especially for an annotation rich format like SwissProt or GenBank.</p>https://www.open-bio.org/2009/06/21/ncbi-einfo-biopython/Sun, 21 Jun 2009 21:42:05 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2009/06/21/ncbi-einfo-biopython/<p>Constructing complicated NCBI Entrez searches can be tricky, but it turns out one of the <a href="http://eutils.ncbi.nlm.nih.gov/corehtml/query/static/eutils_help.html">Entrez Programming Utilities</a> called <a href="http://eutils.ncbi.nlm.nih.gov/corehtml/query/static/einfo_help.html">Entrez EInfo</a> can help.</p> <p>For example, suppose you want to search for mitochondrial genomes from a given taxa - either just in the <a href="http://www.ncbi.nlm.nih.gov/sites/entrez" title="NCBI Entrez">Entrez web interface</a>, for use in a script with <a href="http://eutils.ncbi.nlm.nih.gov/corehtml/query/static/esearch_help.html%3EESearch%3C/a%3E" title="where you might also download them with &lt;a href=">EFetch</a>.</p> <p>I knew from past experience about using <code>name[ORGN]</code> in Entrez to search for an organism name - but how would you specify just mitochondria? I actually worked this out from the NCBI help and exploring the Entrez website&rsquo;s advanced search - but it took a while.</p> <p>There is an easier way to find out the search fields available in Entrez! Just recently I came across an interesting <a href="http://nsaunders.wordpress.com/2009/05/27/querying-ncbi-entrez-database-fields-using-ruby/">blog post from Neil Saunders</a> (written a couple of weeks ago) showing how Entrez EInfo provides information about the search fields in XML format, and how you can use Ruby to process this.</p> <p><a href="http://biopython.org">Biopython</a> can do this too of course - using <a href="http://www.biopython.org/DIST/docs/tutorial/Tutorial.html#chapter:entrez">Bio.Entrez</a> this took just a few lines of Python:</p> <p>`&raquo;&gt; from Bio import Entrez</p> <blockquote> <blockquote> <blockquote> <p>data = Entrez.read(Entrez.einfo(db=&ldquo;genome&rdquo;)) for field in data[&ldquo;DbInfo&rdquo;][&ldquo;FieldList&rdquo;] : &hellip; print &ldquo;%(Name)s, %(FullName)s, %(Description)s&rdquo; % field &hellip; ALL, All Fields, All terms from all searchable fields UID, UID, Unique number assigned to each sequence FILT, Filter, Limits the records WORD, Text Word, Free text associated with record TITL, Title, Words in definition line KYWD, Keyword, Nonstandardized terms provided by submitter AUTH, Author, Author(s) of publication JOUR, Journal, Journal abbreviation of publication VOL, Volume, Volume number of publication ISS, Issue, Issue number of publication PAGE, Page Number, Page number(s) of publication ORGN, Organism, Scientific and common names of organism, and all higher levels of taxonomy ACCN, Accession, Accession number of sequence PACC, Primary Accession, Does not include retired secondary accessions GENE, Gene Name, Name of gene associated with sequence PROT, Protein Name, Name of protein associated with sequence ECNO, EC/RN Number, EC number for enzyme or CAS registry number PDAT, Publication Date, Date sequence added to GenBank MDAT, Modification Date, Date of last update SUBS, Substance Name, CAS chemical name or MEDLINE Substance Name PROP, Properties, Classification by source qualifiers and molecule type SQID, SeqID String, String identifier for sequence GPRJ, Genome Project, Genome Project SLEN, Sequence Length, Length of sequence FKEY, Feature key, Feature annotated on sequence RTYP, Replicon type, Replicon type RNAM, Replicon name, Replicon name ORGL, Organelle, Organelle `</p> </blockquote> </blockquote> </blockquote> <p>That gives us a list of all the fields we can currently search on in the Genome database (and you could use the same code for any of the other NCBI databases in Entrez - they probably all have different searchable fields). Very handy! The ones in bold are discussed below.</p> <p>So for my particular search, using &ldquo;ORGL&rdquo; to filter on organelle looks sensible, and after a bit of trial and error on the website I ended up with <code>mitochondrion[ORGL]</code> as a useful filter (not mitochondrial, or mitochondria).</p> <p>I already knew about using &ldquo;ORGN&rdquo; to filter on the organism, either by species name or with a suitably formatted NCBI taxon ID (which you can get by searching or browsing the Entrez taxonomy database), e.g. <code>txid9443[ORGN]</code> gives <a href="http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9443">primates</a>.</p> <p>Putting these together, to get <a href="http://www.ncbi.nlm.nih.gov/sites/entrez?db=genome&amp;term=txid9443%5BORGN%5D%20AND%20mitochondrion%5BORGL%5D">all the primate mitochondria in the Entrez genome database</a> you could use:</p> <blockquote> <p>txid9443[ORGN] AND mitochondrion[ORGL]</p> </blockquote> <p>Note that you have to use &ldquo;AND&rdquo; in upper case.</p> <p>I think we&rsquo;ll have to add something along these lines to the <a href="http://www.biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial and Cookbook</a> ( <a href="http://www.biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>)&hellip; <em>Update: That&rsquo;s done now and will be included with our next release</em> :)</p> <p>Entrez rocks! (although their documentation could use a few more examples).</p> <p>Peter</p>https://www.open-bio.org/2009/03/27/biopython-on-twitter/Fri, 27 Mar 2009 11:19:56 +0000board@open-bio.org (Open Bioinformatics Foundation)https://www.open-bio.org/2009/03/27/biopython-on-twitter/<p>Just to let you all know, <a href="http://twitter.com/Biopython">Biopython is now on twitter</a>. And in case you missed the <a href="https://www.open-bio.org/news/2009/02/hello-twitter-world/">OBF announcement</a> last month, so is the <a href="http://twitter.com/obf_news">O|B|F News feed</a> (and <a href="http://twitter.com/bioperl">BioPerl</a>). You are welcome to follow us (all) on <a href="http://twitter.com/">twitter</a>.</p> <p>I&rsquo;d also like to remind people there are news feeds for the <a href="http://news.open-bio.org/news/category/obf-projects/biopython/">Biopython news posts</a> (as <a href="http://news.open-bio.org/news/category/obf-projects/biopython/feed/rdf">RDF</a>, <a href="http://news.open-bio.org/news/category/obf-projects/biopython/feed/rss/">RSS</a>, <a href="http://news.open-bio.org/news/category/obf-projects/biopython/feed/rss2/">RSS2</a>, or <a href="http://news.open-bio.org/news/category/obf-projects/biopython/feed/atom">Atom</a> format). We&rsquo;re planning to have these automatically echoed onto twitter in future&hellip; <em>(update)</em> &hellip;and that seems to be working now :)</p>